ID: 938368503

View in Genome Browser
Species Human (GRCh38)
Location 2:130754896-130754918
Sequence TTTAACAAGAGGAGGACTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 151}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938368499_938368503 6 Left 938368499 2:130754867-130754889 CCTAATAAGGAAGGCTAATGCTT 0: 1
1: 0
2: 1
3: 8
4: 114
Right 938368503 2:130754896-130754918 TTTAACAAGAGGAGGACTGTGGG 0: 1
1: 0
2: 0
3: 14
4: 151
938368496_938368503 30 Left 938368496 2:130754843-130754865 CCTTAAATGCAAAAGCGGGGAGA 0: 1
1: 1
2: 1
3: 6
4: 110
Right 938368503 2:130754896-130754918 TTTAACAAGAGGAGGACTGTGGG 0: 1
1: 0
2: 0
3: 14
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938368503 Original CRISPR TTTAACAAGAGGAGGACTGT GGG Intergenic
900858474 1:5205556-5205578 TTTGACAAGATCAGGACTCTGGG - Intergenic
901765297 1:11496254-11496276 TTTCCCAAGAGGAGGATGGTTGG + Intronic
907370380 1:53998775-53998797 TTTAAAAAAAGGCTGACTGTAGG + Intergenic
908012181 1:59789977-59789999 TTTATCAATTGGAGGACAGTGGG + Intergenic
908677229 1:66619083-66619105 TTTAAGAAGAGGAGGTAAGTTGG - Intronic
908908277 1:69041459-69041481 ATTAATAATAGGAGGAATGTTGG + Intergenic
911241105 1:95467887-95467909 ATCAACAAGAGGAGGAATTTTGG - Intergenic
911574592 1:99560295-99560317 ATTCACAAGAGGAGGTCTGAAGG - Intergenic
911901838 1:103516130-103516152 TATGACAAGAGAAAGACTGTAGG + Intergenic
913547194 1:119880821-119880843 GTTTAGAAGAGGAGGACTGCAGG + Intergenic
913557011 1:119977516-119977538 GTTTAGAAGAGGAGGACTGCAGG - Intronic
913583403 1:120249500-120249522 TTTAAAAAGAGAAGTCCTGTAGG + Intergenic
913624769 1:120648822-120648844 TTTAAAAAGAGAAGTCCTGTAGG - Intergenic
914565390 1:148861336-148861358 TTTAAAAAGAGAAGTCCTGTAGG + Intronic
914607435 1:149268912-149268934 TTTAAAAAGAGAAGTCCTGTAGG - Intergenic
915441354 1:155947448-155947470 TTTAAATAAAGGAGGGCTGTGGG - Exonic
917233648 1:172865715-172865737 ATTGACAAGAGGAGAGCTGTGGG + Intergenic
918954965 1:191195676-191195698 TTTAAGAATAGGTGGACTTTGGG - Intergenic
920667430 1:207973158-207973180 TTTCCAAAGAGGTGGACTGTGGG + Intergenic
922119004 1:222644070-222644092 TTTACCTGGAGGAGGATTGTGGG - Intronic
922649697 1:227327181-227327203 TCTAAAAAGAGGGAGACTGTGGG + Intergenic
1063239707 10:4155755-4155777 TTTATTAAGAGGAGAGCTGTAGG + Intergenic
1065756639 10:28936607-28936629 TTTGACAAGGGGAGAACTGGTGG + Intergenic
1068434452 10:56972965-56972987 TGTAACAAGAGCAGCACTGAGGG + Intergenic
1068443753 10:57094757-57094779 TTTTGCAACATGAGGACTGTAGG - Intergenic
1070054751 10:72924056-72924078 GATAACAAGAGGAGGGCAGTGGG + Intronic
1070222812 10:74468636-74468658 TTTCAGAAGAGGAGAACTGTAGG - Intronic
1070229161 10:74545405-74545427 TTTAACAAGCCGTGGACTCTAGG + Intronic
1074497552 10:113993024-113993046 TTTCACATCAGAAGGACTGTCGG - Intergenic
1075440391 10:122475556-122475578 TTTAACAAGAGTAGGTCTGAGGG + Intronic
1077250660 11:1559276-1559298 ATTAGCATGAGGAGGAATGTGGG - Intronic
1079777179 11:24546394-24546416 TTTAGTATGAGGATGACTGTGGG + Intronic
1080948079 11:36997301-36997323 TTTTACAAGAGGAGGAATGCTGG + Intergenic
1083361629 11:62112695-62112717 TTTAAAGAGAGGCTGACTGTGGG + Intergenic
1087974768 11:104531266-104531288 TTTAACAATAGGAAGCCAGTTGG - Intergenic
1088025034 11:105169151-105169173 TTTAAGAAGATGAGCACTTTGGG - Intergenic
1090649784 11:128796209-128796231 TTTATCAAGCATAGGACTGTTGG - Intronic
1094363145 12:29651631-29651653 GTTCACAGGAGGAGGGCTGTGGG - Intronic
1096574448 12:52544104-52544126 TTTAAGAAAAGGAGGACTGAAGG - Exonic
1098376349 12:69819703-69819725 CTAAAGAAGAGGAGGACTCTTGG + Exonic
1099904155 12:88752056-88752078 TTCAACAAAAGGAGGCCAGTTGG - Intergenic
1101720842 12:107349301-107349323 TTTCCCAAGAGGAGGAATGTGGG + Intronic
1101975743 12:109356811-109356833 TCTAACAACAAGGGGACTGTTGG - Intronic
1105441282 13:20416902-20416924 TTCATCTAGAGGAGGGCTGTGGG + Intronic
1106023574 13:25936926-25936948 TTCAATAAGCGGAGGGCTGTAGG - Intronic
1106168131 13:27266913-27266935 GTGAACAAGAGGAGGACCCTTGG + Intergenic
1107637757 13:42409955-42409977 TATAACAAGATAAGAACTGTGGG + Intergenic
1109091976 13:58058864-58058886 TTTAATAAGAAAAGGACAGTTGG - Intergenic
1109790107 13:67235404-67235426 TTCAATTAGAGGGGGACTGTGGG - Intergenic
1110292815 13:73826717-73826739 TTTAAAAAGAGCAAAACTGTAGG - Intronic
1112320261 13:98400004-98400026 TTTAATTAGAGGAAGTCTGTGGG + Intronic
1116500724 14:45617882-45617904 TAGAAGAAGAGGAGAACTGTAGG - Intergenic
1118931865 14:70250174-70250196 TTTCTCAAGAGGAGGCCTTTAGG - Intergenic
1119983013 14:79103262-79103284 TTTAAAAAGAGGAATCCTGTTGG + Intronic
1120613262 14:86669045-86669067 TTTCCCAAGAAGAGTACTGTGGG + Intergenic
1121493446 14:94376286-94376308 TTAAATAAGAGGAGTCCTGTGGG + Intergenic
1124818814 15:33022509-33022531 TTTAACAACTGGAGGTCTGTTGG - Intronic
1125493038 15:40162696-40162718 TTGAGAAAGAGGAAGACTGTGGG + Intronic
1126138242 15:45413215-45413237 TCCAACAAGAGGAGGACTCTGGG - Intronic
1128349020 15:66876692-66876714 TTTAACGAGAAGAGGAATGGTGG - Intergenic
1128552968 15:68609990-68610012 TTTATCAAGAGAAGGAGGGTGGG - Intronic
1131084908 15:89567871-89567893 TTTGACAAGAGGAGTTCTGCTGG - Intergenic
1133664371 16:7951583-7951605 TTGGAGAAAAGGAGGACTGTAGG - Intergenic
1135939687 16:26810244-26810266 TTTAACAAGAAGACTCCTGTGGG + Intergenic
1139076501 16:63456487-63456509 TATAACAGGAGGATGAATGTAGG + Intergenic
1140258079 16:73354056-73354078 TCTAACCAGAGTAGGGCTGTGGG + Intergenic
1141627340 16:85268305-85268327 ATTATCAGGAGGAGGACTGCGGG - Intergenic
1147553413 17:41461076-41461098 TTAAACAAGAGAAGAAATGTAGG - Intronic
1155117936 18:22788057-22788079 TTTAACACAAAGAGAACTGTAGG + Intergenic
1155301428 18:24432949-24432971 TTTAGTAAAAGGAGGACTTTTGG - Intronic
1156999728 18:43510146-43510168 TTTATGAAGAGGAGGAATCTTGG + Intergenic
1158312013 18:56169101-56169123 TTTAATCAGAAGAGGACTGCAGG + Intergenic
1160286557 18:77548662-77548684 TAGAAAAAGAGGAGGATTGTTGG - Intergenic
1160620979 18:80170452-80170474 TCCACCAAGAGCAGGACTGTCGG + Exonic
1167859411 19:52270666-52270688 TTTAACAGGAGGAGCACAGATGG + Intronic
926213698 2:10890519-10890541 TTTAAAAAGAGGAGGGATGCAGG + Intergenic
929104484 2:38350643-38350665 TTTAACAAAAGCACCACTGTGGG + Intronic
933431199 2:82182146-82182168 TTAAACAGTAGGAGAACTGTAGG + Intergenic
933581016 2:84126780-84126802 TGTAACAAGAGGAGGAAGCTTGG - Intergenic
935050088 2:99517946-99517968 ATTAACAAGAGTAGGAGTGTAGG - Intergenic
938368503 2:130754896-130754918 TTTAACAAGAGGAGGACTGTGGG + Intergenic
944785349 2:203064629-203064651 TTTAAAAAAAGGAGGGCTGGAGG + Intronic
945761826 2:213923677-213923699 TTCAACAAAAGTAGGACTGCTGG + Intronic
947867517 2:233409816-233409838 TAAGACAGGAGGAGGACTGTGGG + Intronic
1168765109 20:376878-376900 TTTCACAGGAGGAGAACTGGTGG - Intronic
1170288510 20:14740134-14740156 TTTAATAAGCGGAGGAATTTTGG - Intronic
1172119244 20:32588126-32588148 TTTTAAACGAGCAGGACTGTGGG + Intronic
1174365897 20:50056079-50056101 TTTAACAGGAGTAGGGCTGAGGG - Intergenic
1177569096 21:22863150-22863172 TTTATCAAGATGAGAACTTTGGG - Intergenic
1178753624 21:35327063-35327085 TTTAACAATACAAGGAGTGTAGG + Intronic
1178949712 21:36976047-36976069 TTTATCCAGAGAAGGACTTTGGG - Intronic
950527096 3:13530656-13530678 TTTAAGAAGGGGAGGGATGTGGG - Intergenic
951619421 3:24584629-24584651 TTTAAGAATATGAAGACTGTTGG - Intergenic
954007903 3:47607568-47607590 TCTAAGAAGAGAAGGAATGTGGG + Intronic
955791990 3:62597634-62597656 TGTAACAAGAGTCTGACTGTGGG + Intronic
962214987 3:133513461-133513483 TTTAACAAAAGGAGGAGGTTTGG + Intergenic
963182791 3:142377607-142377629 TTTCTCAAAAGGAGTACTGTTGG - Intronic
974361776 4:60890165-60890187 CTTAACAAGAAGAGGAGTTTAGG + Intergenic
974594226 4:63996023-63996045 TTTGAAAAGAGAAGGAGTGTTGG + Intergenic
974835879 4:67250410-67250432 CTTGACAAGAGGAGAACTGTAGG - Intergenic
976499422 4:85770389-85770411 GTGAACAATAGGAGGACTATTGG - Intronic
977392148 4:96425657-96425679 TTGAGAAAGAGGAGGACAGTAGG - Intergenic
977961017 4:103085567-103085589 TTTTAAAAGGGGAGGAATGTGGG - Intronic
978502390 4:109423165-109423187 ATTAAAACGAAGAGGACTGTTGG + Intergenic
981015216 4:139967406-139967428 TTTCAAAAGGGGAGTACTGTAGG - Intronic
982084824 4:151823809-151823831 TTGGACCAGACGAGGACTGTGGG - Intergenic
984317529 4:178145850-178145872 TTTAAAAAGAGGTAGACGGTTGG + Intergenic
985003346 4:185506870-185506892 TTTGCCAAGTGGAGGAGTGTGGG - Intronic
986071568 5:4289615-4289637 TTTAAATAGAGGATGCCTGTAGG + Intergenic
986453851 5:7895011-7895033 TTTAACTCAAGGACGACTGTAGG - Intronic
987229792 5:15882011-15882033 TGGAGCAAGAGGAGGAGTGTTGG + Intronic
989991395 5:50771568-50771590 TTTAATAAGAAAAGGAATGTGGG - Intronic
991059779 5:62361719-62361741 TTTAAGAAGACAAGAACTGTAGG + Intronic
994506490 5:100649112-100649134 TTTAATAAATGGAGGACTGTAGG - Intergenic
995766469 5:115625177-115625199 TTTACCAATATTAGGACTGTTGG - Intronic
995822848 5:116257026-116257048 TTTAACAAAAACAGCACTGTAGG - Intronic
1001261636 5:170233958-170233980 TTTAACAAGGGGTGGAGTGGTGG - Exonic
1002408320 5:179053726-179053748 TTTGACACCTGGAGGACTGTGGG - Intergenic
1002654184 5:180729975-180729997 TTTAAAAAGAAGAGGAATGAGGG + Intergenic
1002770073 6:282855-282877 ATGAACAGGAGCAGGACTGTAGG - Intergenic
1002806585 6:581956-581978 TTTAACAAGAGAAAAACAGTTGG + Intronic
1003287439 6:4746804-4746826 TTTTCCCAGAAGAGGACTGTTGG + Intronic
1005097343 6:22131920-22131942 TTTACTAAGAAGAGGACTATGGG - Intergenic
1008929794 6:56926707-56926729 TTTATTAAGAGGAAGACTGAAGG + Intronic
1009194897 6:60672266-60672288 ATTACCAGGAGGAGGATTGTAGG + Intergenic
1009300972 6:62020144-62020166 TTTAAGAAGAAAAGGACTATAGG - Intronic
1010097471 6:72063483-72063505 GTTAACCAGAGCAGGACTTTGGG + Intronic
1012283567 6:97360796-97360818 TTTAATGAGAGGAAGACTGATGG + Intergenic
1013134113 6:107263012-107263034 TTTAATAAGAGGATGAGGGTAGG - Intronic
1014269197 6:119317004-119317026 GTTAGCAAGAGGAGAATTGTAGG + Intronic
1014823800 6:126024527-126024549 TTTAAGAAAAGGAAGACAGTCGG - Intronic
1014990736 6:128072812-128072834 TTTAAGATGAGGATGACTGAAGG + Intronic
1020329231 7:7001324-7001346 ATAAACAAGAGCAGGACTGAGGG + Intergenic
1023300511 7:38765964-38765986 TTTACCCAGAGGAGCACTGCTGG + Intronic
1027841172 7:83313907-83313929 TTTAGCTGGAGGAGGTCTGTGGG - Intergenic
1027927051 7:84478957-84478979 TTTGACAAGAGAAGGACTAGAGG - Intronic
1031200405 7:118676616-118676638 TTTAAGATGAGGAAGACTATAGG + Intergenic
1032888627 7:136169297-136169319 TTTATCAAAGGGAGGACTTTGGG - Intergenic
1035566223 8:643178-643200 TTTAACGAGAGGCAGAATGTGGG - Intronic
1038576046 8:28703680-28703702 TTTACCAAGAGTAGGTCTGATGG - Intronic
1038601260 8:28945453-28945475 TATAACAAGAATAGGACTGAAGG + Intronic
1042357494 8:67845067-67845089 TCTAACAATAGGTGTACTGTAGG - Intergenic
1043285582 8:78525487-78525509 TTAAATAAGAGGATGAATGTTGG + Intronic
1047478276 8:125256627-125256649 TTAAAAAAGAAGAGGACTGTTGG + Intronic
1048434811 8:134406331-134406353 ATGTACAACAGGAGGACTGTAGG - Intergenic
1049264156 8:141658053-141658075 TTTAGGAAGAGGAGGAAAGTGGG - Intergenic
1050771436 9:9206292-9206314 TTTTACAAGAGGAGGACCATTGG + Intronic
1051138667 9:13953453-13953475 TTCAACCAAAGGAGGGCTGTAGG + Intergenic
1053799674 9:41756492-41756514 TATAAGAAGAGGAGGAGTGCTGG - Intergenic
1054188083 9:61968547-61968569 TATAAGAAGAGGAGGAGTGCTGG - Intergenic
1054650433 9:67620029-67620051 TATAAGAAGAGGAGGAGTGCTGG + Intergenic
1055597143 9:77876820-77876842 TTTAAAAACTGGAGAACTGTAGG + Intronic
1056774645 9:89501986-89502008 TTTAACAAAAAGAGCTCTGTGGG - Intergenic
1057063976 9:92031377-92031399 TTTAACAAGAGAAGGAATGATGG + Intergenic
1057181950 9:93035159-93035181 TTTGTCAACAGGAGGACGGTCGG - Intronic
1059420644 9:114189281-114189303 TTTAACAAGTGGTTAACTGTTGG - Intronic
1186294061 X:8129648-8129670 TGTAACAAGAGTGGGACTGATGG + Intergenic
1187413710 X:19073932-19073954 TGTAAAAAGAGAAGGACTGCAGG + Intronic
1188508345 X:30907392-30907414 TTTAATAAGGGGAGGGCTTTGGG - Intronic
1195764719 X:108283865-108283887 TTTAATAAAAGGTGGGCTGTGGG + Intronic
1197022006 X:121702434-121702456 ATTAATAAGAGGAGGAATTTTGG - Intergenic
1198190762 X:134302668-134302690 ATTAACAACAAGAGGAATGTTGG + Intergenic
1198203965 X:134448758-134448780 TTTAAAAAAATGAGGCCTGTTGG + Intergenic
1198230879 X:134688113-134688135 TTTACAGAGAGAAGGACTGTGGG - Intronic
1199195152 X:145020539-145020561 TTTAATAAAAGGAAAACTGTAGG - Intergenic
1200933292 Y:8716188-8716210 TCTAACAACTGGAGGACTGTGGG + Intergenic