ID: 938368846

View in Genome Browser
Species Human (GRCh38)
Location 2:130756272-130756294
Sequence GCTCCCGGCGCCGCGCGCCG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 333
Summary {0: 1, 1: 0, 2: 3, 3: 47, 4: 282}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938368846_938368851 15 Left 938368846 2:130756272-130756294 CCGCGGCGCGCGGCGCCGGGAGC 0: 1
1: 0
2: 3
3: 47
4: 282
Right 938368851 2:130756310-130756332 GCGCGGCTCGCGCTCCGACGCGG 0: 1
1: 0
2: 0
3: 2
4: 52
938368846_938368849 -2 Left 938368846 2:130756272-130756294 CCGCGGCGCGCGGCGCCGGGAGC 0: 1
1: 0
2: 3
3: 47
4: 282
Right 938368849 2:130756293-130756315 GCTGACCGTGGTGCTGAGCGCGG 0: 1
1: 1
2: 1
3: 19
4: 260

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938368846 Original CRISPR GCTCCCGGCGCCGCGCGCCG CGG (reversed) Exonic