ID: 938368846 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:130756272-130756294 |
| Sequence | GCTCCCGGCGCCGCGCGCCG CGG (reversed) |
| Strand | - |
| Crispr in exon? | Yes |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 333 | |||
| Summary | {0: 1, 1: 0, 2: 3, 3: 47, 4: 282} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 938368846_938368851 | 15 | Left | 938368846 | 2:130756272-130756294 | CCGCGGCGCGCGGCGCCGGGAGC | 0: 1 1: 0 2: 3 3: 47 4: 282 |
||
| Right | 938368851 | 2:130756310-130756332 | GCGCGGCTCGCGCTCCGACGCGG | 0: 1 1: 0 2: 0 3: 2 4: 52 |
||||
| 938368846_938368849 | -2 | Left | 938368846 | 2:130756272-130756294 | CCGCGGCGCGCGGCGCCGGGAGC | 0: 1 1: 0 2: 3 3: 47 4: 282 |
||
| Right | 938368849 | 2:130756293-130756315 | GCTGACCGTGGTGCTGAGCGCGG | 0: 1 1: 1 2: 1 3: 19 4: 260 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 938368846 | Original CRISPR | GCTCCCGGCGCCGCGCGCCG CGG (reversed) | Exonic | ||