ID: 938370014

View in Genome Browser
Species Human (GRCh38)
Location 2:130762906-130762928
Sequence CCCTGGGAACCTTGCTCTCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 308
Summary {0: 1, 1: 1, 2: 1, 3: 21, 4: 284}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938370014_938370021 -2 Left 938370014 2:130762906-130762928 CCTGGAGAGCAAGGTTCCCAGGG 0: 1
1: 1
2: 1
3: 21
4: 284
Right 938370021 2:130762927-130762949 GGGCCCTCTCCAGGGCAGTGTGG 0: 1
1: 0
2: 3
3: 35
4: 334
938370014_938370018 -10 Left 938370014 2:130762906-130762928 CCTGGAGAGCAAGGTTCCCAGGG 0: 1
1: 1
2: 1
3: 21
4: 284
Right 938370018 2:130762919-130762941 GTTCCCAGGGGCCCTCTCCAGGG 0: 1
1: 0
2: 3
3: 28
4: 286
938370014_938370025 7 Left 938370014 2:130762906-130762928 CCTGGAGAGCAAGGTTCCCAGGG 0: 1
1: 1
2: 1
3: 21
4: 284
Right 938370025 2:130762936-130762958 CCAGGGCAGTGTGGAGCAGCTGG 0: 1
1: 0
2: 3
3: 67
4: 500

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938370014 Original CRISPR CCCTGGGAACCTTGCTCTCC AGG (reversed) Exonic
900188550 1:1343879-1343901 ACCTGGCCAGCTTGCTCTCCTGG - Intronic
900366978 1:2315358-2315380 CCCTGCCAACCCTGCCCTCCCGG + Intergenic
900394626 1:2448143-2448165 CCCGGGGCACCTGGCGCTCCAGG - Intronic
900548902 1:3243835-3243857 CCCTGGAAACACTGCACTCCAGG - Intronic
900856732 1:5191551-5191573 CCCTGGTAAGCTTGCTTTCAAGG - Intergenic
901018281 1:6243811-6243833 CCCTGGAATGCTTGCACTCCAGG + Intergenic
902409670 1:16205627-16205649 CCCTGGCATCCTGGCTCGCCTGG - Exonic
905285391 1:36876280-36876302 TCCTGGCAACCTTGAACTCCAGG - Intronic
905648052 1:39638380-39638402 TCATGGCAACCTTGATCTCCTGG - Intronic
906056772 1:42924205-42924227 CCCTGGGGACGTAGCTCACCCGG - Intergenic
906452329 1:45961157-45961179 CCCTGGGATCCCTGTTCTCTTGG - Intronic
907714934 1:56917543-56917565 CCCTGGGAAATTTCCTCTGCAGG + Exonic
908006629 1:59734851-59734873 CCCTGGGCACCTTGGCCCCCAGG - Intronic
908153032 1:61324196-61324218 CCCTGGGGACACTGCTCTCAGGG - Intronic
909523685 1:76598348-76598370 GCATGGGATCCCTGCTCTCCTGG - Intronic
909542570 1:76807257-76807279 CTCTGGAAACCTTGCCCTCAAGG - Intergenic
910314677 1:85868798-85868820 CCCTGGAGACCTTCTTCTCCAGG + Exonic
910981892 1:92966266-92966288 CCCCAGGACCCTTGCCCTCCAGG + Intergenic
911162734 1:94697859-94697881 CCCTGAGCAGCTTGCACTCCAGG + Intergenic
913319029 1:117575855-117575877 GCCTGGGAAGCTTGGGCTCCTGG + Intergenic
914205182 1:145520587-145520609 CCTTGTGACCCTTGCTTTCCAGG + Intergenic
915455177 1:156035766-156035788 CCCAAGGGACCTAGCTCTCCCGG + Exonic
915587036 1:156849470-156849492 GCCAGGGGACCTTGCTCTGCGGG + Intronic
915604045 1:156939763-156939785 CCCTGGGACCCAGGCTCCCCAGG - Exonic
916511444 1:165475323-165475345 CACTGGGAACCCAGCTGTCCAGG + Intergenic
917493041 1:175514549-175514571 CCCTGGGAACCATGGTTCCCTGG - Intronic
920049962 1:203157903-203157925 CTCTGGAAACCTTGCTCTAAAGG + Intronic
922778747 1:228232913-228232935 CCCTGGAAAACTCGCTCACCAGG - Intronic
924456403 1:244222395-244222417 CACTGCGAGCCTTGCTGTCCCGG + Intergenic
1062834767 10:628528-628550 CCCTGGGAGCCTCGCTCTGATGG + Intronic
1063301182 10:4850190-4850212 CTCTGTGGACCTTGGTCTCCAGG - Intergenic
1063485891 10:6420450-6420472 CCATGGGATCCTTGGTTTCCAGG + Intergenic
1063701427 10:8388582-8388604 CAGTGGGAACCTGGTTCTCCTGG - Intergenic
1067048494 10:42999166-42999188 CCCTGGGCATCTTACCCTCCTGG - Intergenic
1067249331 10:44574070-44574092 CCCTGGAAAGCATGCTGTCCTGG - Intergenic
1067348519 10:45455589-45455611 CCTTGGAAAACTTGCTCTCTCGG - Exonic
1067532765 10:47086472-47086494 CCCTGGGATTCCTGATCTCCTGG - Intergenic
1071511381 10:86264558-86264580 TTGTGGAAACCTTGCTCTCCAGG - Intronic
1071514899 10:86290934-86290956 CCCTGGGCCGCTTCCTCTCCAGG - Intronic
1072594865 10:96862161-96862183 CCCTGGGCACACTACTCTCCAGG + Intronic
1074609300 10:115005778-115005800 CCACTGCAACCTTGCTCTCCCGG + Intergenic
1074634902 10:115304090-115304112 CCCTCTGACCCTTTCTCTCCAGG + Intronic
1074974161 10:118566843-118566865 TCCAGGGAACCTGGCTCTGCTGG + Intergenic
1075204993 10:120439396-120439418 CCCTCTGGACATTGCTCTCCAGG + Intergenic
1076198871 10:128541681-128541703 CACAGGGAATCTTCCTCTCCAGG - Intergenic
1077492540 11:2868803-2868825 CCCAGGCAGCCTTCCTCTCCTGG + Intergenic
1079081303 11:17415273-17415295 TCCTGGGAACATTGCCCCCCAGG - Intronic
1080443176 11:32313824-32313846 GCCTGGGGACCTTGACCTCCAGG + Intergenic
1081617114 11:44597559-44597581 CCCCGGGGACTTTGCTCTCTGGG + Intronic
1082771456 11:57210930-57210952 CCCTGGGAACCTTGAGGTCCTGG + Intergenic
1082803662 11:57432656-57432678 CCCCGGGCACCTTTCTCTCTTGG + Intergenic
1082961709 11:58924131-58924153 CCCTGAGCAGCTTGCACTCCAGG + Intronic
1083223585 11:61269327-61269349 CCCTGGAACCCTGGCTCACCAGG + Intronic
1083701371 11:64480509-64480531 CCATGGCAGCCTTGATCTCCTGG + Intergenic
1086381740 11:86261872-86261894 CTCTGGAAACCTTGCCCTCAAGG + Intronic
1087319371 11:96639524-96639546 CCCAGAGAACCTTTCTCTTCTGG - Intergenic
1087791465 11:102410607-102410629 TCCTGGCATCCTTGCTCTCCAGG + Intronic
1087917614 11:103829530-103829552 CTCTGAAAACCTTGCTCTCAAGG - Intergenic
1088186425 11:107176548-107176570 TCCTGGGAACCTCTCTCGCCAGG + Intergenic
1088499666 11:110471153-110471175 CCCTGGGAAGCTGACTTTCCTGG + Intergenic
1088616388 11:111633748-111633770 ACCTGGGTAACTTGTTCTCCAGG + Intronic
1089063229 11:115643092-115643114 CCCTGGACACAGTGCTCTCCTGG - Intergenic
1090173164 11:124622954-124622976 CTCTAGGAATCTAGCTCTCCGGG - Exonic
1090387452 11:126365145-126365167 CCCTGGGGGACATGCTCTCCTGG + Intronic
1090390018 11:126382343-126382365 CCCTGGGGGACATGCTCTCCTGG + Intronic
1091160706 11:133417033-133417055 CTCTGGGCACCTTACTCTCCAGG - Intronic
1091379391 12:46191-46213 CCCAGAGAACCCTGCTCCCCTGG - Intergenic
1091702943 12:2676141-2676163 CCCAGGGAACCTAGGACTCCAGG + Intronic
1092495091 12:8985745-8985767 CTCTGGGAAGGCTGCTCTCCAGG + Intronic
1092791795 12:12076691-12076713 GCCAGGGACCCTTGCTTTCCTGG + Intronic
1094371145 12:29739149-29739171 CCCTGTAAACCTTCATCTCCAGG + Intronic
1096707201 12:53429809-53429831 CCCTTCGTGCCTTGCTCTCCAGG + Exonic
1097186902 12:57200903-57200925 CCCACGGCAGCTTGCTCTCCAGG + Intronic
1098480646 12:70955694-70955716 TCATGGGAACCCTGCACTCCTGG + Intergenic
1101696002 12:107127445-107127467 CCCTAGAAACCTTGCTTCCCTGG - Intergenic
1102559757 12:113753822-113753844 CCCTGGACCCCTTGCTCTCTGGG - Intergenic
1103018608 12:117515505-117515527 AGCTGAGATCCTTGCTCTCCTGG + Intronic
1103455274 12:121060406-121060428 GCCTGAGAACCTTCCTCTCAAGG - Intergenic
1104679945 12:130743191-130743213 TCCTGGGGGCCATGCTCTCCAGG + Intergenic
1104729116 12:131095255-131095277 GCCTGGGCACCTTGCAGTCCTGG + Intronic
1104844759 12:131841230-131841252 CCTTGGGAACCATGCAGTCCTGG + Intronic
1105313461 13:19235157-19235179 CCCCAGGAACCTAGCTCCCCAGG + Intergenic
1111681028 13:91441575-91441597 TCCTGGGACCTTTGCTTTCCTGG + Intronic
1113533455 13:111045907-111045929 CCCTGGGAGCCATCCTCCCCTGG - Intergenic
1118982010 14:70724764-70724786 CCCTGGGGCCCTCGCTCCCCAGG + Intronic
1119745823 14:77043265-77043287 TTCTGGGAAGCTGGCTCTCCGGG - Intergenic
1120759347 14:88271971-88271993 CCCTGATAACCTTGTTCTCTGGG - Intronic
1121250789 14:92497980-92498002 CCATGGGAACCATCCTCCCCTGG + Exonic
1121278426 14:92683283-92683305 CCCTGGAAACCCTGGTCTCTCGG - Intronic
1122406248 14:101502849-101502871 CCCTGGAAACCTTGGTCCCCTGG + Intergenic
1123107014 14:105846381-105846403 CCCTGGGTACCCAGGTCTCCAGG - Intergenic
1127322724 15:57863373-57863395 CCCTGTGGACCTTGCTCACCTGG + Intergenic
1127579743 15:60327496-60327518 CTCTGGGAGCCTTGCTCCACTGG - Intergenic
1128775825 15:70319566-70319588 CCCTCTGCACCCTGCTCTCCTGG - Intergenic
1129239036 15:74240952-74240974 CCCCAGCAGCCTTGCTCTCCTGG - Intronic
1129679255 15:77648790-77648812 CCTTGTGCACCCTGCTCTCCAGG + Intronic
1130650684 15:85760543-85760565 CCCTGGGAACCTAGTTTCCCAGG + Exonic
1131100985 15:89690260-89690282 CCCTCCTAACTTTGCTCTCCGGG - Intronic
1134894333 16:17871259-17871281 CCCTGGGAACTAGGCTCTCGAGG - Intergenic
1135254151 16:20927170-20927192 CTCTGGAAACCTTGCCCTCAAGG + Intergenic
1137908540 16:52351618-52351640 ACCTGGGGACCTTGCACTCTCGG - Intergenic
1139850429 16:69948913-69948935 GCCCATGAACCTTGCTCTCCTGG + Intergenic
1139879413 16:70171826-70171848 GCCCATGAACCTTGCTCTCCTGG + Intergenic
1140373111 16:74423723-74423745 GCCCATGAACCTTGCTCTCCTGG - Intergenic
1140953671 16:79842981-79843003 TCCCGGGAGCCCTGCTCTCCAGG + Intergenic
1141202904 16:81911394-81911416 CCCTGGGAGCCTGGCTTTTCAGG + Intronic
1141760340 16:86025028-86025050 CCATGAGATCCTTACTCTCCTGG + Intergenic
1142057882 16:88011342-88011364 ACCTGAGAAGTTTGCTCTCCAGG - Intronic
1142114404 16:88348756-88348778 CCCTGGGACCCCAACTCTCCAGG + Intergenic
1144212249 17:13025562-13025584 CACTCTGCACCTTGCTCTCCAGG + Intergenic
1144219373 17:13086157-13086179 TTGTGGGAGCCTTGCTCTCCAGG + Intergenic
1144721689 17:17475618-17475640 CCCTGGCCACCTTGCTCTTAAGG + Intergenic
1145200307 17:20938745-20938767 CCCTGGCAGCCTGGCGCTCCGGG - Intergenic
1145879312 17:28342091-28342113 CCCTATGATCCTTTCTCTCCTGG + Intronic
1145971919 17:28961135-28961157 CCCTGTGAACCTGCATCTCCAGG + Intronic
1146372259 17:32272495-32272517 CTCTGGGAACCCTGCTCTGCTGG - Intronic
1148748604 17:49931919-49931941 ACCTGCGCACCCTGCTCTCCAGG - Intergenic
1149542696 17:57479723-57479745 CCATGAGAACCTTGCTGTCCAGG - Intronic
1149629923 17:58114291-58114313 CTCTGGCCACCTTGATCTCCTGG + Intergenic
1150126334 17:62637673-62637695 CCCTGGGAAGCTGGTGCTCCTGG - Intronic
1150773617 17:68061921-68061943 ATGTGGGCACCTTGCTCTCCAGG + Intergenic
1151049817 17:70964774-70964796 CCCTGGAAACCTAGCTAACCTGG + Intergenic
1151292023 17:73157195-73157217 CCCTGGGAACCCTGTTATCTGGG - Intergenic
1151686797 17:75652315-75652337 GCTTGGGAATCTTGCTCTCCTGG - Intronic
1151837566 17:76593280-76593302 TCCTGGGCACCCTGCCCTCCTGG - Intergenic
1151895041 17:76974534-76974556 CCTGGGGAACCTTGCAGTCCTGG + Intergenic
1151953087 17:77366012-77366034 CCCTGGGGCCCTTGGTGTCCTGG - Intronic
1153414906 18:4835901-4835923 CCCTGGGAACCATTCTCTTAAGG - Intergenic
1154115516 18:11610039-11610061 CACTGAGAACCTGGCTCTCAAGG - Intergenic
1154141184 18:11826198-11826220 CCCTTGGAGCCTGGCTCTCTGGG - Intronic
1155237609 18:23836689-23836711 CCCTGGGGCCCTTTCTCTCGAGG + Intronic
1155560751 18:27073576-27073598 CCCTAGGAACCTTCCTGTCTAGG - Intronic
1159673002 18:71246419-71246441 CCATGGCAACCTTGACCTCCTGG + Intergenic
1159931333 18:74315729-74315751 CCCTGCAAGCCTTGCGCTCCTGG - Intergenic
1160010948 18:75106844-75106866 CCCTGGGTACTCCGCTCTCCCGG + Intergenic
1160299331 18:77666150-77666172 ACCTGGGAGTCTTGCTCTGCTGG - Intergenic
1160598420 18:79993966-79993988 GCCTGGGGACCTGGCTCTTCAGG - Intronic
1160995322 19:1879680-1879702 CCCAGGGAACCTGGCTCCACAGG + Intronic
1162326241 19:10001610-10001632 CCCTGGCTGCCTTGGTCTCCAGG + Exonic
1162753235 19:12841338-12841360 CTCTCCGAGCCTTGCTCTCCTGG + Intronic
1164684299 19:30156896-30156918 CCCTGGGATGCTTGTTCTGCAGG + Intergenic
1165813658 19:38627782-38627804 CTCTGGGTCCCTTGCTCTCTTGG + Intronic
1166122391 19:40693434-40693456 AACTGGGATCCTTGCTCTCACGG - Intronic
1167292147 19:48630230-48630252 CCCGGGGAACCTGCCCCTCCTGG - Exonic
1167426436 19:49432148-49432170 CCCTAGGACCCTGTCTCTCCAGG + Intronic
1167446862 19:49543001-49543023 CTCTGGGACCCTTGTTCTCTGGG - Intronic
1167857421 19:52253926-52253948 CCCAGGGTAGCTTGCTCTCTAGG - Intergenic
925350123 2:3195215-3195237 CCATGGGTTCTTTGCTCTCCTGG - Intronic
925352587 2:3211913-3211935 CCCACGGAACCTTCCACTCCAGG + Intronic
925833137 2:7915948-7915970 CCCTGGGAACCTGGCTTATCAGG + Intergenic
927139020 2:20117475-20117497 TCCTTGGACCCTTGCTCTGCTGG + Intergenic
927717891 2:25364315-25364337 CCCTGGGGACCATGCCTTCCTGG - Intergenic
929782806 2:44968217-44968239 TCCTGTGAACCTTGCTTTCTGGG - Intergenic
931630309 2:64292528-64292550 ACCAGATAACCTTGCTCTCCTGG + Intergenic
932265569 2:70364659-70364681 GCCGGGTCACCTTGCTCTCCAGG + Intergenic
932698853 2:73979364-73979386 CCCTGAGTACCTTCCTTTCCTGG + Intergenic
935444262 2:103139660-103139682 CCCTGGGTGCCTTCCTGTCCGGG - Intergenic
936564376 2:113571736-113571758 CCCAGAGAACCCTGCTCCCCTGG + Intergenic
937150908 2:119685038-119685060 CCTTGTGAACATTGTTCTCCTGG + Intronic
937231858 2:120402709-120402731 CCCAGGAAACCTTGCTCTGCTGG + Intergenic
938209852 2:129458443-129458465 ACCTGGGAGCCTTGCTCTGGGGG + Intergenic
938322964 2:130377537-130377559 CCCTGGTAACCTTACCCTCCAGG + Intergenic
938370014 2:130762906-130762928 CCCTGGGAACCTTGCTCTCCAGG - Exonic
946180645 2:217947066-217947088 CCCTGGGAACCCTGGTCCTCAGG - Intronic
946292116 2:218753355-218753377 CCCTGGGTACCTTTCTTTCAAGG + Intronic
947443557 2:230144483-230144505 CCCTGGGAACCTTAAACTCTGGG + Intergenic
947463230 2:230321176-230321198 CCCTGGGAACCAGGCTTTGCTGG - Intergenic
947874853 2:233461276-233461298 CCCTGGGCTCCTTCTTCTCCTGG + Intronic
948283809 2:236769016-236769038 CCCTTGGCTCCTTCCTCTCCAGG - Intergenic
948566419 2:238890098-238890120 CCAGGTGAACCTCGCTCTCCAGG - Intronic
948831757 2:240601769-240601791 CCCTGGGTACCTGGACCTCCAGG + Intronic
1168986289 20:2051773-2051795 CACTGCTAACCTTCCTCTCCAGG + Intergenic
1169044956 20:2527836-2527858 TGCTGGGGACTTTGCTCTCCTGG + Intergenic
1169207291 20:3747692-3747714 CCCTGGGAACAAAGTTCTCCTGG + Intronic
1169760759 20:9091047-9091069 CCCTGGGGACCCTGGTCTCTGGG - Intronic
1169771693 20:9208161-9208183 CCCTGGGACCCTTCCTCTTAAGG - Intronic
1170333682 20:15244431-15244453 CCCTGGTATCCCTGCTGTCCAGG - Intronic
1171293085 20:23993804-23993826 TCGTGTGAGCCTTGCTCTCCTGG + Intergenic
1171485867 20:25485269-25485291 TGCTGGGAAACTTACTCTCCAGG + Intronic
1172774994 20:37402159-37402181 CCCTGGTCACCTCGCTTTCCTGG + Intronic
1173704029 20:45096983-45097005 CCCTGGCAAGCTTGCACTCAAGG - Intronic
1174077862 20:47951079-47951101 ACCCGGGAACCGTGCTCTGCAGG + Intergenic
1174077903 20:47951210-47951232 CCTGGGGAACCGTGCTCTGCAGG + Intergenic
1174077914 20:47951246-47951268 CCCGGGGAACCGTGCTCTGCAGG + Intergenic
1174077926 20:47951282-47951304 CCCGGGGAACCGTGCTCTGCAGG + Intergenic
1174077939 20:47951325-47951347 ACCCGGGAACCGTGCTCTGCAGG + Intergenic
1174077968 20:47951412-47951434 ACCCGGGAACCGTGCTCTGCAGG + Intergenic
1174077983 20:47951456-47951478 ACCCGGGAACCGTGCTCTGCAGG + Intergenic
1174379255 20:50146249-50146271 CCCTGGAAACCTCCATCTCCAGG + Intronic
1176005512 20:62860739-62860761 TCCTGGGAACCATGTGCTCCGGG - Intronic
1176159940 20:63642758-63642780 CCCTGGGGACCCTCCGCTCCTGG - Intronic
1176243862 20:64088158-64088180 CCCTGGGAACCTTCCTAACTTGG - Intronic
1179349755 21:40597246-40597268 CCCTGTGAATATTGCTCTCAGGG - Intronic
1179584225 21:42364853-42364875 CCATGGGAACCTTGCCCTCCTGG + Intronic
1180824148 22:18851520-18851542 TCATGTGAGCCTTGCTCTCCTGG + Intronic
1181040084 22:20187972-20187994 GCCTGGGGTCCTTGCTCACCAGG - Intergenic
1181124574 22:20694674-20694696 TCGTGTGAGCCTTGCTCTCCTGG + Intergenic
1181188589 22:21123028-21123050 TCGTGTGAGCCTTGCTCTCCTGG - Intergenic
1181210611 22:21287465-21287487 TCGTGTGAGCCTTGCTCTCCTGG + Intergenic
1181398901 22:22639426-22639448 TCGTGTGAGCCTTGCTCTCCTGG - Intergenic
1181437666 22:22919888-22919910 CCCTGGGAACCTGCAGCTCCAGG - Intergenic
1181438314 22:22922943-22922965 CCCTGGGAACCTGCAGCTCCAGG - Intergenic
1181501632 22:23318772-23318794 TCGTGTGAGCCTTGCTCTCCTGG - Intergenic
1181570204 22:23764255-23764277 CCCAGCGACCATTGCTCTCCTGG + Exonic
1181650520 22:24256633-24256655 TCGTGTGAGCCTTGCTCTCCTGG + Intergenic
1181706861 22:24654105-24654127 TCGTGTGAGCCTTGCTCTCCTGG - Intergenic
1182117981 22:27768323-27768345 CCCTGGGGGCCTGGTTCTCCAGG - Intronic
1182549176 22:31091757-31091779 CCCTGGGACCCTGGCTCGGCTGG + Exonic
1184501701 22:44878638-44878660 AGCTGGGCACCCTGCTCTCCAGG + Intergenic
1184880066 22:47299137-47299159 CTCTGTGAACCCTGCTCTCCAGG - Intergenic
1184897993 22:47423432-47423454 CCCTGGAAACCCTGCTCTTCTGG + Intergenic
1185215760 22:49599181-49599203 CCCGGTGACCCTTTCTCTCCTGG - Intronic
1203216337 22_KI270731v1_random:7965-7987 TCGTGTGAGCCTTGCTCTCCTGG - Intergenic
1203274286 22_KI270734v1_random:77424-77446 TCGTGTGAGCCTTGCTCTCCTGG + Intergenic
950304808 3:11909661-11909683 CCCTGGGAACCGGGCTGTGCTGG + Intergenic
951746515 3:25983941-25983963 CCCCTGGATCCTTGCCCTCCTGG - Intergenic
952952033 3:38533114-38533136 CCCTTGGAACCCTGCTCTCAGGG + Intronic
954710616 3:52503537-52503559 GCCTGGGACCCTGGCTCACCTGG - Exonic
958767305 3:98384923-98384945 CCATGGGAACCTAGGTCTCAGGG - Intergenic
959534312 3:107468207-107468229 CTCTTGCAACCTTGATCTCCTGG - Intergenic
959897425 3:111620269-111620291 CACTGGGAATACTGCTCTCCTGG - Intronic
961867370 3:129963562-129963584 CCCTGGGATCCTTGTGCCCCAGG - Intergenic
963992200 3:151667818-151667840 CCCAGGGAACCTTTGTCTTCTGG + Intergenic
968509036 4:987343-987365 CTCTGGGGCCCTGGCTCTCCCGG + Intronic
969927010 4:10594375-10594397 CACTTGGAAGCTTGCACTCCTGG + Intronic
971471386 4:27030688-27030710 ACCTGGGAACTCTGCTCTTCAGG + Intergenic
983269003 4:165539171-165539193 CTCCGGGAATCTTGGTCTCCTGG - Intergenic
985213976 4:187629178-187629200 GCCTGGGAACCTGGGTCTGCAGG - Intergenic
985656326 5:1133413-1133435 CCCTGGAAACCCTGCCCTGCTGG + Intergenic
986568187 5:9136444-9136466 CCATGGGAGCCATGCTCCCCTGG - Intronic
990886891 5:60604728-60604750 CCCTGGGGTCCATGGTCTCCAGG - Intronic
991667972 5:69018879-69018901 ACCTGTAATCCTTGCTCTCCTGG + Intergenic
996188902 5:120514228-120514250 CTCTGGAAACCTTGCTCTCAAGG + Intronic
1001804852 5:174574840-174574862 CCCTGTGACACTTCCTCTCCTGG - Intergenic
1002712693 5:181204752-181204774 GCCTGAGACCCGTGCTCTCCCGG + Exonic
1003121051 6:3319247-3319269 CCCTGCTGACCTTCCTCTCCCGG + Intronic
1003361932 6:5435011-5435033 ACCTGGGAACCTTGTTATCATGG - Intronic
1003503076 6:6718295-6718317 CCATGAGAAGCTGGCTCTCCTGG - Intergenic
1004373726 6:15074400-15074422 CCCTAGGAAGCTGGCACTCCAGG - Intergenic
1005095380 6:22109388-22109410 CCCTGTAAATCTTGCTCTGCAGG + Intergenic
1005360214 6:25024197-25024219 TCCTGGGCACCTTTCTCGCCAGG - Intronic
1006187261 6:32188575-32188597 GCCTGGGAACTTGGCTCTCCAGG - Intronic
1006334430 6:33413203-33413225 CCCTGGGAACATGGCAGTCCTGG - Exonic
1007673918 6:43579481-43579503 CCCTGGGAACACCACTCTCCAGG - Intronic
1007912424 6:45529307-45529329 CACTGGGAAATGTGCTCTCCAGG - Intronic
1007927549 6:45662636-45662658 CCCTGAGAGCCTCGCTCTGCTGG + Intronic
1008850806 6:56018833-56018855 CCATGGGAGCCTTGTTCTCTTGG + Intergenic
1008882949 6:56399982-56400004 CCCTGAGCAGCTTGCACTCCAGG - Intergenic
1015265418 6:131287553-131287575 CCTTGTGAACCTTGCTTCCCTGG + Intergenic
1015355810 6:132275713-132275735 CTCTGTGATCCTTCCTCTCCAGG + Intergenic
1016325635 6:142898221-142898243 CTCTGGGATCCTTGATTTCCTGG - Intronic
1019179950 6:170180190-170180212 ACCTCTGAACCTTGCTCTCTGGG - Intergenic
1019290962 7:249992-250014 CAGTGGGGACCTTGCTCTGCAGG - Intronic
1019451244 7:1099689-1099711 CCCTGGCAACCAAGCTCTGCAGG - Intronic
1019501727 7:1368253-1368275 CCCTGGGAAGATGGCTCTCCAGG + Intergenic
1019537512 7:1537038-1537060 CCCTGGCAACCTTGACCTCCTGG + Intronic
1020271938 7:6602104-6602126 ACCTGAGAACCTTGTGCTCCAGG + Exonic
1022764965 7:33401686-33401708 TCAAGGGAACCTTGGTCTCCAGG - Intronic
1023755249 7:43410026-43410048 CCCAGGGATCCCAGCTCTCCGGG + Intronic
1023904678 7:44513732-44513754 CCCTGGGACCCTTCCTGCCCTGG - Intronic
1024294927 7:47834109-47834131 CCATGGCAACCCGGCTCTCCAGG - Intronic
1024472766 7:49780469-49780491 TCATGGGAATCTTGGTCTCCTGG + Intronic
1024581904 7:50807456-50807478 CCCTGGGATCCTTCCTGCCCTGG + Intergenic
1024766729 7:52668907-52668929 CCCTGGGAATATTCCTCTGCAGG - Intergenic
1025262121 7:57426443-57426465 ACCTGTGAACCTGGCTCCCCAGG + Intergenic
1029546174 7:101211759-101211781 CCCTGGGCACCGGGCTCCCCAGG - Intronic
1029624906 7:101714567-101714589 TCCTGGGAACTTGGCTTTCCTGG - Intergenic
1034166332 7:149028094-149028116 CCCCGGCCACCTTCCTCTCCCGG + Intronic
1034487211 7:151373568-151373590 CCCTGGAGTCCTTGCTCCCCAGG + Intronic
1035597125 8:866907-866929 CCCTGGGAACGTGGCTTCCCTGG - Intergenic
1036626784 8:10479177-10479199 CCCTAGGGAGCTTGCTCTCAAGG - Intergenic
1039398727 8:37249319-37249341 GCCTGAAAACCTTCCTCTCCTGG + Intergenic
1040543631 8:48380595-48380617 CCCTGGAAGCCGTCCTCTCCCGG - Intergenic
1042944898 8:74144970-74144992 CCCTGGGTTCCTTTCTCTTCTGG + Intergenic
1044248849 8:89983787-89983809 CCCTGGAGACCTGGCTCTTCTGG - Intronic
1046471660 8:114682768-114682790 CTCTGGAAACCTTGCCTTCCAGG + Intergenic
1046542801 8:115608567-115608589 CTCTTGGAACCTTAGTCTCCTGG + Intronic
1049661248 8:143820570-143820592 TGCTGGGGACCTTGCTCCCCTGG - Intronic
1049888047 9:41472-41494 CCCAGAGAACCCTGCTCCCCTGG - Intergenic
1049916445 9:322516-322538 CCCTGGGAACCTTGCTTTCCTGG + Intronic
1056792716 9:89636519-89636541 CCCTGGGAGCCCACCTCTCCAGG + Intergenic
1057180120 9:93025210-93025232 CCCTGAGTACCTGGCTCCCCAGG - Intronic
1057302744 9:93896143-93896165 CTCTGGGCACCTAGCTCTCACGG - Intergenic
1058271365 9:102975783-102975805 CCCTGGAAACCTTGCCTTCAAGG + Intergenic
1058934139 9:109752343-109752365 TCCTGGGAATCTTGCTATACTGG + Intronic
1060282055 9:122221403-122221425 CCCTGGGACCCTCGCTTTGCGGG + Intronic
1060552631 9:124492802-124492824 CCCTGGGAGCCCTGCTCTTGGGG - Intronic
1060726201 9:126007458-126007480 ACCTGAGAACCTTGAACTCCAGG - Intergenic
1060919022 9:127407342-127407364 CCCTTGGAGCCTTGGTCTGCAGG + Exonic
1061204465 9:129155027-129155049 CTCTGGGAGGCTTCCTCTCCTGG + Intergenic
1061233405 9:129328105-129328127 CCCTGGATACCCTGCTGTCCAGG - Intergenic
1061479513 9:130890148-130890170 CCCTGGGCACAGTTCTCTCCTGG - Intergenic
1061735267 9:132651530-132651552 CTCTGGGAACTTCGCTCTCAAGG + Intronic
1061818597 9:133210135-133210157 CCTTGGGCACCTGGCTCTGCTGG + Intergenic
1185782978 X:2865197-2865219 CCCTGGGAAGCTTGTTTTCAGGG - Intronic
1187225590 X:17373347-17373369 CCCTTGAACCCTTTCTCTCCTGG + Intergenic
1188832750 X:34920311-34920333 CCCTGGGATACCTTCTCTCCAGG + Intergenic
1188939168 X:36216036-36216058 CCCTGAGCAGCTTGCACTCCAGG - Intergenic
1191096081 X:56674047-56674069 CCCATGGAACCTTGCTCACTGGG + Intergenic
1192585716 X:72316782-72316804 CCATGGGAACCTTCCTCCCCTGG - Intergenic
1198723231 X:139647597-139647619 CACTGGGATCCATGCTTTCCAGG - Intronic
1199500144 X:148499685-148499707 GCCAGGGAACCTTTCCCTCCAGG + Intergenic
1201618340 Y:15926817-15926839 CCCTGAGCAGCTTGCACTCCAGG - Intergenic
1202031813 Y:20583297-20583319 TCATGGGAACCTTGAACTCCTGG - Intronic
1202143146 Y:21750386-21750408 CCCTGGGAACCTGGTTCTGCTGG - Intergenic
1202258868 Y:22948637-22948659 CCCTGAGCAACTTGCACTCCAGG - Intergenic
1202411856 Y:24582395-24582417 CCCTGAGCAACTTGCACTCCAGG - Intergenic
1202458926 Y:25087677-25087699 CCCTGAGCAACTTGCACTCCAGG + Intergenic