ID: 938370064

View in Genome Browser
Species Human (GRCh38)
Location 2:130763125-130763147
Sequence GAGGGTCCCTGCAGGGGCAG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 592
Summary {0: 1, 1: 1, 2: 5, 3: 56, 4: 529}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938370064_938370072 11 Left 938370064 2:130763125-130763147 CCTCTGCCCCTGCAGGGACCCTC 0: 1
1: 1
2: 5
3: 56
4: 529
Right 938370072 2:130763159-130763181 AAAGCCAGCTCCATCGACACAGG 0: 1
1: 0
2: 0
3: 9
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938370064 Original CRISPR GAGGGTCCCTGCAGGGGCAG AGG (reversed) Exonic
900127038 1:1073269-1073291 GAGGGCCCAGGCAGGGGCAGGGG + Intronic
900143082 1:1146634-1146656 GAGGGGCTCTGCCTGGGCAGAGG + Intergenic
900400770 1:2472042-2472064 AGGGGTCCCAGCAAGGGCAGGGG - Intronic
900507895 1:3038789-3038811 GGGGGTTGCGGCAGGGGCAGGGG + Intergenic
900514347 1:3074119-3074141 GAGGTTGCCGGCAGGGGCCGGGG - Intronic
900646463 1:3711018-3711040 GAGGGACCCTGCATGGTGAGAGG + Intronic
901122200 1:6905125-6905147 GAGGGCCCAAGCTGGGGCAGTGG - Intronic
901153839 1:7122460-7122482 GATGGTCCCTGAAAGTGCAGTGG + Intronic
901382879 1:8886660-8886682 GAGAGACCCTGCAGAGTCAGAGG - Intergenic
901735392 1:11309171-11309193 CAGGGTCCATGCAGGGGCCTGGG - Intergenic
902417698 1:16251171-16251193 GACGGCCCCTGCAAGGGCACTGG + Exonic
902763459 1:18599421-18599443 GAGTGTCCCTGCAGGAAAAGAGG + Intergenic
903216440 1:21846083-21846105 GAGGGTCCCTGCAGTGGGACGGG - Intronic
903386989 1:22933396-22933418 TGGGGGCCCTGCAGGGGAAGAGG - Intergenic
903542526 1:24105075-24105097 GAGGGGCGGGGCAGGGGCAGGGG - Intronic
903613882 1:24637898-24637920 GATGATCCCTGCAGATGCAGTGG - Intronic
903743765 1:25573383-25573405 GGTGGTCCCTGCAGGGGCTCAGG + Intergenic
904912023 1:33942194-33942216 GTAGCTCACTGCAGGGGCAGAGG + Intronic
905741393 1:40374095-40374117 CAGGGTGCCGGCGGGGGCAGAGG - Exonic
905874435 1:41423133-41423155 GGGGGTCCCTGGAGGGGCCCAGG + Intergenic
905924313 1:41739157-41739179 CTGGGGCCATGCAGGGGCAGAGG - Intronic
906588474 1:47001540-47001562 GAGGCTTCCTAGAGGGGCAGTGG + Intergenic
907268148 1:53275226-53275248 GAGGGTCCCTGCTCCTGCAGAGG + Intronic
907385343 1:54122156-54122178 GAGGGGCACGGCAGGGGTAGTGG - Intergenic
907493441 1:54825820-54825842 GTGGGTGCCAGCAGTGGCAGTGG + Intronic
912240185 1:107898586-107898608 TAGGGTCCCTGCAGGGTAATAGG + Intronic
912431080 1:109628809-109628831 GAGTGTCCCTGGAGTGGGAGGGG + Intronic
912735134 1:112143693-112143715 GAGGGTCTCATCAGGGGCTGAGG + Intergenic
913191458 1:116416653-116416675 CAGGGCCACTGCAGGGCCAGAGG + Intergenic
913967092 1:143385359-143385381 GAGGGTGACTGCAGGAGCTGGGG + Intergenic
914061468 1:144210966-144210988 GAGGGTGACTGCAGGAGCTGGGG + Intergenic
914117682 1:144755403-144755425 GAGGGTGACTGCAGGAGCTGGGG - Intergenic
914382732 1:147132852-147132874 GATGCTCCATGGAGGGGCAGTGG - Intergenic
914985086 1:152449651-152449673 TAAGGTCAGTGCAGGGGCAGGGG - Intergenic
915224479 1:154402477-154402499 GAGGGTCCCTGCAGGAACACCGG + Intergenic
915580384 1:156809569-156809591 GAGGGGCCTAGCGGGGGCAGAGG - Intronic
916634726 1:166656310-166656332 CAGGGTCCCTGCATGGCCTGAGG + Intergenic
917641275 1:176985333-176985355 GAGTGTCAATGCATGGGCAGTGG - Intronic
919513882 1:198497555-198497577 GAGGGTACCAGCAGTAGCAGAGG - Intergenic
919792230 1:201299572-201299594 GCTGGTCCCTCCAGGGTCAGAGG + Intronic
919858100 1:201719423-201719445 GAGGGTCCCTGCAGGGCAAAAGG - Intronic
919858851 1:201725039-201725061 GAGGGTAGCTGCAGAGGCTGGGG - Intronic
920034413 1:203056566-203056588 TGCGGTCCCTGCAGAGGCAGAGG - Intronic
922424572 1:225481040-225481062 GAGGGAGCCAGCAGGGGCTGTGG - Intergenic
922483738 1:225957400-225957422 GAGGGTCCCAGCTGGGGCCTGGG + Intergenic
924902102 1:248411993-248412015 GAGAGTCCCTACTGGGGCAATGG + Intergenic
1062907639 10:1189621-1189643 GAGGGTGTCTGCAGCTGCAGGGG + Intronic
1063392511 10:5659621-5659643 GAGGCTTCCTGAAGGAGCAGGGG - Intronic
1064710238 10:18115821-18115843 GATGGCACCTGCAGGAGCAGTGG - Intergenic
1067058181 10:43064485-43064507 GGGGTTTCCTGTAGGGGCAGAGG + Intergenic
1070162082 10:73872937-73872959 GAGGGTGCCTCCAGGGGCCATGG - Intronic
1070598786 10:77851320-77851342 AAGGGTCCCTGCAGGGGGAATGG + Intronic
1070727420 10:78802028-78802050 GAGGATCACTCCTGGGGCAGAGG - Intergenic
1071027680 10:81135946-81135968 GGTGGTGCCTCCAGGGGCAGAGG - Intergenic
1073118690 10:101108201-101108223 AGGGGTCACAGCAGGGGCAGGGG + Intronic
1073173883 10:101538331-101538353 GAGTGTCCCTGCAGGAGCACGGG - Exonic
1073498851 10:103918241-103918263 GTTGGTCCCTGGCGGGGCAGGGG - Intergenic
1074150975 10:110759593-110759615 GCTAGTCCCAGCAGGGGCAGAGG + Intronic
1074186063 10:111100360-111100382 GAGGGGCACTGCAGGAGCAAAGG + Intergenic
1074786659 10:116848142-116848164 CTGGGGCCCTGCAAGGGCAGAGG - Intergenic
1075299647 10:121310496-121310518 GTGGCTCCCTGCAGGGACAGGGG + Intergenic
1075697805 10:124448977-124448999 GCGGCTCCCTGGAGGGTCAGAGG - Intronic
1076151847 10:128168934-128168956 GTTGGTCCCTCCAGGAGCAGTGG - Intergenic
1076195605 10:128515453-128515475 GAGGGGCCCTCCAAGGGCTGGGG + Intergenic
1076595107 10:131620395-131620417 GAGGGGCCCTGCAGCTGCAGAGG + Intergenic
1076697466 10:132253879-132253901 GCGGGTCCCTGCAGGGCGGGAGG - Intronic
1076750398 10:132539251-132539273 GTCTGTCCCTGCAGGGCCAGAGG + Intronic
1076815267 10:132911461-132911483 GAGTGTCTCCGCAGGGGCACGGG - Intronic
1076892786 10:133292947-133292969 GAGAGACTCTGCAGGGGCCGTGG - Intronic
1076944701 10:133637969-133637991 GTGGCCCCCTCCAGGGGCAGGGG - Intergenic
1076995664 11:296429-296451 GAGGGAGCCTGTAGGGGCCGGGG - Intergenic
1077109491 11:855849-855871 CTGGGTCCCTGCAGGGGCCAGGG - Intronic
1077390586 11:2299073-2299095 CAGGGTGCCTCCAGGGGAAGGGG + Intronic
1077459243 11:2700483-2700505 GAGGGTCGCTGCAGCGGCGCCGG - Intronic
1077481502 11:2816938-2816960 GAGGGGACCTCCAGAGGCAGAGG - Intronic
1077495178 11:2883873-2883895 GAGGGAACCTGCCGGGGCAGCGG - Exonic
1077500571 11:2908152-2908174 TGGGGTCCCTGGATGGGCAGGGG - Intronic
1078441561 11:11372622-11372644 CAGGGCTCCTGCAGGGGCAGGGG + Exonic
1081589379 11:44410423-44410445 GAGTGTGCCTGCAAAGGCAGTGG + Intergenic
1081605823 11:44526557-44526579 GAGGGGCTCTGCAGGGGCTCAGG - Intergenic
1081810240 11:45910305-45910327 GAGCGGCCCTGCAGTGGGAGAGG + Intronic
1082634840 11:55583447-55583469 CAGGGTCCCTGCAGGTCCACCGG + Intergenic
1082785236 11:57313098-57313120 GAGTGTCTCAGCAGGGGCAAGGG - Exonic
1082821267 11:57546094-57546116 GAGGGTGGCCTCAGGGGCAGTGG + Intronic
1083254076 11:61485712-61485734 CAGTGTCCCAGCAGGTGCAGAGG - Intronic
1083665484 11:64271855-64271877 GAGGGTTCAGGCAGGGCCAGGGG - Intronic
1083674417 11:64317441-64317463 GCGGGTACCTGGAGGCGCAGGGG + Exonic
1083742281 11:64717259-64717281 CAGTGTCCCTGCACTGGCAGTGG - Intronic
1083968115 11:66055349-66055371 TTAGGTCCCTGAAGGGGCAGTGG + Intronic
1084116555 11:67045957-67045979 CAGGGCCCCTGCAGGGGTAGTGG + Intronic
1084447568 11:69212648-69212670 GAGGGCCCCTGCAGAGCCAATGG - Intergenic
1084548001 11:69823949-69823971 GTGGGCCCCTCCAGGGGCCGGGG - Intergenic
1085054110 11:73394158-73394180 GGGGTTCTCTGCTGGGGCAGGGG + Intronic
1085402202 11:76241796-76241818 GAGGCTGCCCGAAGGGGCAGGGG + Intergenic
1087496275 11:98894175-98894197 GAAGTTTGCTGCAGGGGCAGGGG - Intergenic
1088597426 11:111450710-111450732 CCCGGTCCCTGCAGGGTCAGAGG + Intronic
1089115196 11:116089354-116089376 GAGGGTAGCTGCAGAGGCACAGG - Intergenic
1089253072 11:117179063-117179085 CAGGGTCCCCGCAGGGGAGGGGG - Exonic
1089500571 11:118929283-118929305 GAGGGGGCCGGCTGGGGCAGGGG + Intronic
1089566824 11:119376097-119376119 GAGGGTTCCTACTGGGGCCGGGG + Intronic
1089618591 11:119709408-119709430 GGGAGAGCCTGCAGGGGCAGGGG + Intronic
1089701392 11:120246200-120246222 GAGAGACCCTGCAGTGGCACCGG + Intronic
1089810092 11:121124631-121124653 GAGGGCTCCTTGAGGGGCAGGGG + Intronic
1090037710 11:123263229-123263251 GCTGGTTGCTGCAGGGGCAGCGG + Intergenic
1090263521 11:125339626-125339648 GAGGGGCCCTGCTGGGGCCCAGG - Intronic
1090401062 11:126448558-126448580 GAGGAGCTTTGCAGGGGCAGGGG + Intronic
1090682622 11:129077624-129077646 GAGGGTTGCTGCAGGTGCTGTGG - Intronic
1091193158 11:133711031-133711053 GAGGGTACCTGCAGTGGCCCAGG - Intergenic
1091218396 11:133917361-133917383 GAGGCTGACTGCGGGGGCAGGGG + Intronic
1091225988 11:133956645-133956667 GAGGGCGCCGGGAGGGGCAGGGG + Intronic
1091649304 12:2298045-2298067 GAGGGTCCAGGCAAGGGCTGTGG + Intronic
1091722243 12:2821677-2821699 CAGTGTCCCTGCCGGGGGAGAGG - Exonic
1092197863 12:6560735-6560757 GATGCTCCCTGCAGTGGCACTGG - Exonic
1092615465 12:10212445-10212467 GAGGGCCGCGGGAGGGGCAGCGG + Intronic
1094574216 12:31669350-31669372 GAAGGTCACAGCAGGGGCACAGG - Exonic
1095672538 12:44876901-44876923 GAGGTTCCCTGCCGGGGGCGGGG + Exonic
1095946782 12:47758344-47758366 GGAGATCCCTGCAGGGGCATGGG - Intronic
1096578949 12:52572088-52572110 CAGGGTCCCTGCAGGGTCTCTGG + Intronic
1096630754 12:52925482-52925504 GGGGATACCTGCAGGGGAAGAGG - Intronic
1096798024 12:54090706-54090728 TGGGGCCACTGCAGGGGCAGGGG + Intergenic
1100713645 12:97283513-97283535 GAGGGACCCTGCAGGAGGAGGGG + Intergenic
1102031443 12:109742158-109742180 GAGGGTGCCTGTAAGTGCAGAGG + Intronic
1102254436 12:111407418-111407440 CAGGGCCCCTGCCAGGGCAGTGG + Intronic
1102968685 12:117148794-117148816 GAGCGTCCCTTTGGGGGCAGCGG - Intronic
1103721079 12:122975876-122975898 GAGGAGCTGTGCAGGGGCAGGGG - Intronic
1103856080 12:123972443-123972465 GAGGGGCCGGGCAGGGGCGGAGG - Intronic
1104422244 12:128645682-128645704 GGGGGCCCCTGCTGGGGCACTGG - Intronic
1104603452 12:130169450-130169472 GTGGGTCTCTCCAGGGACAGAGG + Intergenic
1104640019 12:130461330-130461352 AGGGGTGCCAGCAGGGGCAGGGG + Intronic
1104700025 12:130895891-130895913 GAGGATTACTGCAGGGGCTGAGG + Intergenic
1104820727 12:131675851-131675873 CTGGCTCCCTGCAGGGGCAAGGG - Intergenic
1104880161 12:132065182-132065204 GAGGGACCCTGCAGGGACCAAGG + Intronic
1105621520 13:22071998-22072020 TAGGGGCCCTGGAGGGGCTGGGG + Intergenic
1107872988 13:44764160-44764182 GAGGGCTCCTGAAGGGGAAGTGG - Intergenic
1108373494 13:49792819-49792841 GAGAGCCCTTGCAGGGGAAGAGG - Exonic
1109103061 13:58211275-58211297 GTGGGGCCGTGCAGGGGCGGAGG - Intergenic
1113561446 13:111284848-111284870 GAGGGCACCTGCAGGCGCAGAGG - Intronic
1113728768 13:112625043-112625065 GAAGGTCACTGCAGGTGCACTGG + Intergenic
1113834431 13:113319454-113319476 GCGTGTCTCTGCAGGTGCAGTGG - Exonic
1113903007 13:113806830-113806852 GAGGAGGCCCGCAGGGGCAGAGG + Intronic
1113956308 13:114101446-114101468 GCGGGGCCCAGCACGGGCAGTGG - Intronic
1114306570 14:21429073-21429095 GAGGGTGGCTGCTGGGGCTGTGG + Exonic
1114529607 14:23387693-23387715 GGAGGGCCATGCAGGGGCAGGGG - Intronic
1117422329 14:55559059-55559081 CAGAGTCCCTGGAGGGGAAGAGG - Intronic
1118334028 14:64836548-64836570 GAGGGTCACAGAAGGGGCAATGG - Intronic
1118447339 14:65863644-65863666 GTGGGTCCCATCAGGAGCAGAGG - Intergenic
1118865914 14:69703441-69703463 GGGGGTCTCTGCAGGGCCGGGGG - Exonic
1119414410 14:74460010-74460032 GGGGGTCCCTGGAGGTCCAGGGG - Intergenic
1119655484 14:76414039-76414061 CGGGGACCGTGCAGGGGCAGGGG - Intronic
1119655538 14:76414184-76414206 GGGGGACGCTGCAGGGGCGGGGG - Intronic
1120111345 14:80560998-80561020 GTGGGTCCCTGCAGGACCACAGG - Intronic
1120136668 14:80878101-80878123 CAGGGTCCCTGCTGGGGGAGGGG - Intronic
1120190577 14:81436252-81436274 GAGGGGCCCCGCAGGTGGAGCGG - Intronic
1120999622 14:90442397-90442419 GAGGGTCCAGGCAAAGGCAGAGG - Intergenic
1121440028 14:93942690-93942712 GAGGGGCCCAGCATGGGCAGTGG + Intronic
1121645872 14:95516720-95516742 GCGGGTCCCGGCGGGGGCGGGGG - Intronic
1122152613 14:99732988-99733010 AAGTGTCCCTGGAGGGACAGAGG - Intergenic
1122369604 14:101222064-101222086 TAGGCCCCCAGCAGGGGCAGGGG - Intergenic
1122417790 14:101558526-101558548 GAGGGTTGCTCCAGAGGCAGAGG + Intergenic
1122766823 14:104078133-104078155 GAGGGACACTGCAGGAGGAGCGG + Intergenic
1122899572 14:104776805-104776827 GAGGGCCCTGGGAGGGGCAGGGG - Intronic
1122900938 14:104782098-104782120 CAGGGCCCCTGCAGGTGCAGCGG + Intronic
1122981339 14:105193577-105193599 GGGGCTCCCTGGAAGGGCAGTGG - Intergenic
1123025857 14:105423615-105423637 CCGCGGCCCTGCAGGGGCAGGGG - Intronic
1123038169 14:105479689-105479711 GGGGGCCCCTGCAGGGTCTGGGG - Exonic
1123688870 15:22820681-22820703 GAGGCTCCCCGCAGGGCCTGAGG - Intronic
1123707175 15:22959025-22959047 GAGGGCCCCACCTGGGGCAGTGG - Intronic
1123813728 15:23955247-23955269 GCGGCTCTCTGCAGGGTCAGAGG + Intergenic
1123834019 15:24169630-24169652 GAGTGACCCTGCTAGGGCAGTGG + Intergenic
1123840748 15:24244670-24244692 GAGTGACCCTGCTAGGGCAGTGG + Intergenic
1123849809 15:24343195-24343217 GAGTGACCCTGCTAGGGCAGTGG + Intergenic
1123935667 15:25192854-25192876 GAGGGAGCCGGCATGGGCAGTGG + Intergenic
1125766654 15:42140970-42140992 GAGAGTCCCTGGCGGGTCAGGGG + Exonic
1127935481 15:63632998-63633020 GAGGGAGTGTGCAGGGGCAGAGG + Intronic
1128148079 15:65343884-65343906 CAGGGTCCCTGGTGGGGTAGTGG + Intronic
1128344678 15:66845964-66845986 GAGTGTACCTGCTGGGTCAGGGG - Intergenic
1128514538 15:68334106-68334128 GAGGCTCCCAGCAGAGGGAGTGG - Intronic
1128524237 15:68401674-68401696 GTGGGTCCCTGGAGGGGCACTGG + Intronic
1128783398 15:70377541-70377563 GAGTGTCACTGTGGGGGCAGGGG + Intergenic
1129121264 15:73398220-73398242 AAGGGTGCCTGAAGGGGGAGTGG - Intergenic
1129161310 15:73749496-73749518 GTGGGTACCTGCCGGGGCATAGG + Intronic
1129267219 15:74400194-74400216 CAGGGCCCCTGCAGGGGTTGAGG - Intergenic
1130808489 15:87352415-87352437 AAGGGCCTCTGCAGGGCCAGTGG + Intergenic
1132351668 15:101143060-101143082 AAGGGTGCAGGCAGGGGCAGGGG + Intergenic
1132570371 16:641620-641642 CAGGGGCCCTGCGGGGTCAGCGG - Intronic
1132589400 16:720127-720149 TAGAGCCCCTGCAGGGACAGAGG - Intronic
1132602568 16:780182-780204 GAGGGTCCCGGCGGGAGCAGGGG + Intronic
1132622318 16:873646-873668 GAGGGTCCCCGCGAGCGCAGGGG - Intronic
1132731113 16:1362467-1362489 CAGAGGCCCTGCAGCGGCAGTGG + Exonic
1132854230 16:2037717-2037739 GAGGCTGCCTGCTGGGGCTGGGG - Intronic
1132891455 16:2206879-2206901 TAGGCTCCCTGCTGGAGCAGAGG + Intronic
1133774121 16:8884524-8884546 GTGGGTCCCTGCAGGGTAGGGGG + Intergenic
1134084295 16:11345889-11345911 GCGGGGACCCGCAGGGGCAGAGG - Intronic
1135513950 16:23113739-23113761 GAGGGGACCTTCAGGAGCAGAGG + Intronic
1136004398 16:27318768-27318790 GTGGGTCCCGGGAGGGGAAGAGG + Intronic
1136006855 16:27336712-27336734 GAAGGTCCCTCCAGGTGGAGGGG + Intronic
1136397992 16:30003442-30003464 GGGAGTCCCTGAAGGGCCAGGGG + Intronic
1137274138 16:46922461-46922483 GAGAGTTCCTGCTGGGCCAGTGG + Intronic
1137755456 16:50898629-50898651 AAAGTTCCCTGCAGGGTCAGTGG - Intergenic
1138483290 16:57318376-57318398 GAGGGCCCCTGCAGGGGGCGGGG - Intergenic
1139597803 16:67968401-67968423 GAGGGGCCGTGGCGGGGCAGCGG - Intronic
1139667263 16:68466298-68466320 GAAGTTGCCTGCAGGGGCTGGGG + Intergenic
1140573467 16:76136197-76136219 CAGTGCCCCTGCAGGGGCACTGG - Intergenic
1141501376 16:84446638-84446660 CAGGGTCCCTGGAGTAGCAGCGG + Intronic
1141811321 16:86378190-86378212 GAAGGTGCCAGGAGGGGCAGGGG + Intergenic
1142600719 17:1052362-1052384 GAGGGTTCCGGAAGGGGCTGGGG + Intronic
1142600736 17:1052406-1052428 GAGGGTTCCGGAAGGGGCTGGGG + Intronic
1142600753 17:1052450-1052472 GAGGGTTCCGGAAGGGGCTGGGG + Intronic
1142600770 17:1052494-1052516 GAGGGTTCCGGAAGGGGCTGGGG + Intronic
1142600787 17:1052538-1052560 GAGGGTGCCGGAAGGGGCTGGGG + Intronic
1142600805 17:1052582-1052604 GAGGGTTCCGGAAGGGGCTGGGG + Intronic
1142600823 17:1052626-1052648 GAGGGTTCCGGAAGGGGCTGGGG + Intronic
1142600841 17:1052670-1052692 GAGGGTTCCGGAAGGGGCTGGGG + Intronic
1142600858 17:1052714-1052736 GAGGGTTCCGGAAGGGGCTGGGG + Intronic
1142600874 17:1052758-1052780 GAGGGTTCCGGAAGGGGCTGGGG + Intronic
1142600891 17:1052802-1052824 GAGGGTTCCGGAAGGGGCTGGGG + Intronic
1142600908 17:1052846-1052868 GAGGGTTCCGGAAGGGGCTGGGG + Intronic
1142600942 17:1052934-1052956 GAGGGTTCCGGAAGGGGCTGGGG + Intronic
1142600958 17:1052978-1053000 GAGGGTTCCGGAAGGGGCTGGGG + Intronic
1142600975 17:1053022-1053044 GAGGGTTCCGGAAGGGGCTGGGG + Intronic
1142600992 17:1053066-1053088 GAGGGTTCCGGAAGGGGCTGGGG + Intronic
1142601010 17:1053110-1053132 GAGGGTTCCGGAAGGGGCTGGGG + Intronic
1142601028 17:1053154-1053176 GAGGGTTCCGGAAGGGGCTGGGG + Intronic
1142601046 17:1053198-1053220 GAGGGTTCCGGAAGGGGCTGGGG + Intronic
1142601063 17:1053242-1053264 GAGGGTTCCGGAAGGGGCTGGGG + Intronic
1142601080 17:1053286-1053308 GAGGGTTCCGGAAGGGGCTGGGG + Intronic
1142850317 17:2701566-2701588 GAGGGTCCCTGGCGGGGTGGAGG - Intronic
1143017277 17:3897735-3897757 GTGGGTCCCAGCCAGGGCAGAGG - Exonic
1143049058 17:4107628-4107650 GGGTGTCCATGCAAGGGCAGGGG + Intronic
1143102991 17:4514340-4514362 GAGGGCCCAGGCAGGGGAAGGGG - Intronic
1143471261 17:7177462-7177484 GGGCGACCCTGCAGGGCCAGAGG + Intronic
1143510476 17:7392971-7392993 CAGGGTCACTGCGGAGGCAGGGG + Intronic
1143565815 17:7719901-7719923 GTGGGTACTTGCTGGGGCAGAGG + Intronic
1143608366 17:8003526-8003548 GGGGGTCACGGCAGGGGCCGTGG - Exonic
1144788939 17:17846955-17846977 GAGGGTCCCTGCAGGCTCCCTGG - Exonic
1144863850 17:18322625-18322647 GAGGGTACCGGCACCGGCAGGGG - Exonic
1145003207 17:19320064-19320086 GAGGGCCTCTGCAGGGGCTCAGG + Intronic
1145251443 17:21298938-21298960 GAGAGGCCCTGCAGGGGTGGCGG - Intronic
1145939962 17:28738080-28738102 GGTGGGGCCTGCAGGGGCAGGGG - Exonic
1146586001 17:34082192-34082214 GAGAGTGCCTGAAGGAGCAGAGG - Intronic
1146828653 17:36047398-36047420 GAGGTTCCCTGGCAGGGCAGTGG - Intergenic
1146933144 17:36792329-36792351 GGGCGTCCCTGGGGGGGCAGTGG - Intergenic
1147212560 17:38880376-38880398 GAGGGCTCCTGCAGGGACTGGGG + Intronic
1147258221 17:39194673-39194695 GAGGGGCCGGGCAGGGGCGGGGG + Intronic
1147290622 17:39439648-39439670 AAGGGTTCCTGCCGGTGCAGTGG + Intronic
1147311085 17:39596592-39596614 GCGGGATCCAGCAGGGGCAGGGG - Intergenic
1147604982 17:41769389-41769411 GAGGGTCCCTGCTAGGGTGGGGG - Intronic
1147961510 17:44170534-44170556 AAGGGTATCGGCAGGGGCAGGGG + Intronic
1148131560 17:45265318-45265340 CAGGGTCCTGGCAGGGGCTGGGG + Intronic
1148689689 17:49520144-49520166 GAGGGTCAGTGTGGGGGCAGGGG - Intergenic
1148796386 17:50199320-50199342 GCGGGTCCCTGCAGGGGGAGAGG + Exonic
1148923970 17:51065711-51065733 GAGGCTACCTGCAGGGGCTGGGG - Intronic
1149439609 17:56663582-56663604 GAGAGTCCTTGCTGGGGTAGTGG - Intergenic
1149459146 17:56813122-56813144 CAGGGACCCGGCAGGGGCTGGGG - Intronic
1150644785 17:66971215-66971237 GAGGGTCCTTGCTGGAGGAGGGG + Intronic
1150915405 17:69431680-69431702 GAGGGACCCTGCAAAGGGAGGGG - Intronic
1151355556 17:73555948-73555970 GATGGTCCCTGCAGGGAGACAGG + Intronic
1151466574 17:74289579-74289601 GGGGGTCCCTGCAGGGGAGAGGG - Exonic
1151505191 17:74522794-74522816 GAGGGTCCCTGAGGAGCCAGGGG - Exonic
1152068878 17:78125560-78125582 GTGGGTCCCTGCAGAGGGACGGG + Intronic
1152093078 17:78257644-78257666 GAGGGTCAGTGCTGGGACAGGGG - Intergenic
1152146084 17:78569757-78569779 GAGAGGCCCTCCAGGGACAGGGG + Intronic
1152247238 17:79191446-79191468 TAGGGGGCATGCAGGGGCAGGGG - Intronic
1152544953 17:80995759-80995781 GTGAGTCTCTGCAGGGCCAGGGG + Intronic
1152588919 17:81201682-81201704 GAGGGCTCCTCCAGGGGCAGTGG - Intronic
1152731992 17:81977149-81977171 GAGGATCCGTACAGGGGCGGGGG + Intronic
1153229049 18:2919719-2919741 CATGGGCCCTGCAGGGGCGGGGG + Exonic
1153382404 18:4454679-4454701 CAGGGTCCCGGAAGGGGGAGGGG - Intronic
1153516000 18:5901832-5901854 GTGGGGCCCTGGAGGGACAGTGG - Intergenic
1153988158 18:10371590-10371612 TCGGGACCCTGCTGGGGCAGGGG - Intergenic
1154492813 18:14934247-14934269 CAGGGGCCATGCATGGGCAGGGG + Intergenic
1155161139 18:23196779-23196801 GAGGGAGCCTGCAGGGGCCTTGG - Intronic
1155493555 18:26422112-26422134 CAGGGCCCCTGCAGGGACACGGG - Intergenic
1156265425 18:35483783-35483805 GTGGTTACCTGCAGGGGCAGAGG + Intronic
1157224394 18:45849385-45849407 GAGGATCCCTGCAGAGTGAGAGG + Exonic
1157780127 18:50430880-50430902 GAGGGTGCAGGCAGGGCCAGAGG + Intergenic
1158725628 18:59969323-59969345 GAGGCTCCCTGCAACGGGAGAGG - Intergenic
1160861459 19:1238784-1238806 CAGGGCACCTGCAAGGGCAGAGG - Intergenic
1160887285 19:1355720-1355742 GAGGTTCCCAGCAGAGGTAGGGG - Intronic
1160920100 19:1515534-1515556 CAGGGTCCAGGCAAGGGCAGGGG - Intergenic
1161027755 19:2044483-2044505 GAGGGTCCCAGCAGGTGCCAGGG - Intronic
1161075933 19:2285789-2285811 GAGGGTGCCGGCATGGGCTGGGG + Intronic
1161160337 19:2758034-2758056 GAGGACCCCTGCAATGGCAGCGG + Intronic
1161170149 19:2808451-2808473 GCGGGCCCGGGCAGGGGCAGGGG + Intronic
1161238081 19:3207771-3207793 GGGCGGCCCTGCAGGGACAGGGG + Exonic
1161251188 19:3281184-3281206 GAGGCTCCCTGCAGGGGCAGCGG - Exonic
1161364025 19:3868328-3868350 GAGGGTGCCTGGCCGGGCAGGGG - Intronic
1161653871 19:5501280-5501302 GGGAGACCCTGCAGGGGAAGGGG - Intergenic
1161767776 19:6216558-6216580 GAGGGGCCCTGGAGGCTCAGTGG - Intronic
1162439409 19:10683316-10683338 GTGCCTCCCTCCAGGGGCAGGGG - Intronic
1162806405 19:13139963-13139985 AGGGGTCTCTCCAGGGGCAGGGG + Exonic
1162959430 19:14117408-14117430 GAGGGGCCCCGTAGGGGGAGGGG + Intronic
1164435104 19:28222137-28222159 GAGGATCCCAAAAGGGGCAGTGG - Intergenic
1164545485 19:29158330-29158352 GAGGGGCTCTGGAGTGGCAGTGG + Intergenic
1164752690 19:30668488-30668510 GAGGGTCCCTGCAGTCCCAAAGG + Intronic
1165210444 19:34231537-34231559 GAGGGGCCCTGCAGAAGGAGCGG - Intergenic
1165460091 19:35939355-35939377 GAGGGGTTCTGCAGGGGCTGGGG - Intronic
1165487071 19:36102603-36102625 CAGGGTACGAGCAGGGGCAGTGG - Intronic
1165759719 19:38313845-38313867 GAAGGTCTCTGCAAAGGCAGGGG - Intronic
1165830768 19:38729194-38729216 AGGGGTCCCTGCAGTGGGAGGGG + Intronic
1165901034 19:39169457-39169479 GAGGGACAGAGCAGGGGCAGAGG + Intronic
1166432976 19:42742010-42742032 GGAGCTCCCTGCAGGGGGAGTGG + Intronic
1166650619 19:44571828-44571850 GAAGGTCCCTGCAGAGGTGGTGG - Intergenic
1166803133 19:45470135-45470157 GAGGTCCCATGCAGGGGCGGGGG - Intronic
1167124271 19:47538644-47538666 CAGGGGCTCTGCTGGGGCAGTGG - Intronic
1167145580 19:47679599-47679621 GACGGGCGCTGGAGGGGCAGCGG + Exonic
1167437825 19:49490161-49490183 GAGGGTGACTGCATAGGCAGTGG + Intronic
1167619900 19:50554996-50555018 GCGGGTGACTGCAGGGGCTGAGG - Intronic
1168288826 19:55347307-55347329 TGGGGTCCCAGCAGGGGCTGGGG - Exonic
1202632883 1_KI270706v1_random:16331-16353 GACTGGACCTGCAGGGGCAGGGG + Intergenic
1202700875 1_KI270712v1_random:162854-162876 GAGGGTGACTGCAGGAGCTGGGG + Intergenic
925750881 2:7090028-7090050 GGGGCTCCCTGCAGGGGCACAGG - Intergenic
926220485 2:10932730-10932752 GGGGGACCCTGCAGGGGGAGCGG - Intergenic
926345041 2:11937095-11937117 GTGGGTCCTTCCAGGGACAGAGG + Intergenic
927810102 2:26175803-26175825 GAAGGGCCCTACTGGGGCAGTGG - Intronic
927812357 2:26187232-26187254 GCGGGTTCCCGCAGTGGCAGTGG + Exonic
927890236 2:26743537-26743559 GAGGTCCGCAGCAGGGGCAGGGG + Intergenic
928186661 2:29116009-29116031 GAGAGTCCCCGCACGCGCAGTGG + Intronic
928189674 2:29151942-29151964 GAGGGGAGCGGCAGGGGCAGGGG - Intronic
931429541 2:62197187-62197209 GGGGGGCCCTGCCGGGGCTGCGG + Intronic
933760527 2:85668903-85668925 GAGAGCCCCTGCAGCTGCAGAGG - Intergenic
933773639 2:85758972-85758994 GAGGGACCCTGAAGGGAGAGAGG - Intronic
934171803 2:89546343-89546365 GAGGGTGACTGCAGGAGCTGGGG + Intergenic
934282112 2:91620661-91620683 GAGGGTGACTGCAGGAGCTGGGG + Intergenic
934736741 2:96693491-96693513 GAAGGGCCCTGGAGGGGTAGAGG - Intergenic
935217880 2:100988885-100988907 GTGGGGGCCTGGAGGGGCAGGGG - Intronic
937227049 2:120375997-120376019 GAGGGTCGCTGCATTGCCAGGGG - Intergenic
938370064 2:130763125-130763147 GAGGGTCCCTGCAGGGGCAGAGG - Exonic
939043631 2:137223131-137223153 GAGTGTCCCTGTATGGGCTGTGG + Intronic
946035127 2:216735910-216735932 GAGGGACCATACAGGGGCTGTGG + Intergenic
946225840 2:218263611-218263633 AAAGGTGCCTGCAGGGGCTGTGG + Exonic
946273819 2:218615770-218615792 CGGGGCCCCTGCAGGGGAAGAGG + Intronic
946415741 2:219538861-219538883 GCAGGCCCCAGCAGGGGCAGGGG + Intergenic
947263078 2:228246412-228246434 TGTGGTCCCTGTAGGGGCAGTGG - Intergenic
947435442 2:230068452-230068474 GGGGGTCCCTGGGGGTGCAGCGG + Intronic
947737564 2:232464482-232464504 GAGGCTTCCTCTAGGGGCAGAGG - Intergenic
948450818 2:238070088-238070110 GAGGCTCGCTGCAGCAGCAGTGG + Intronic
948467274 2:238158553-238158575 GGGGGTCCCTGCAGAGGACGTGG + Intergenic
948699121 2:239749520-239749542 GACGGGCCCTGCACGGGGAGAGG - Intergenic
948730933 2:239963328-239963350 GAGGGACCCTCCAGGGCCAGGGG + Intronic
949021646 2:241744157-241744179 GAGGGGCCCTGGAGGAACAGTGG - Intronic
1169081228 20:2798751-2798773 GAGGGTCCCTGCTGGAGTGGGGG + Exonic
1171849857 20:30300536-30300558 TGGGGACACTGCAGGGGCAGGGG + Intergenic
1172184230 20:33021356-33021378 GAGGGGCCCTGCTGGGGTGGAGG - Intronic
1172804372 20:37600798-37600820 GTGGGTTCCAGCAGGGTCAGTGG + Intergenic
1173557289 20:43974828-43974850 GAGCGATCCTGCAGCGGCAGGGG - Intronic
1173799336 20:45885155-45885177 GAGGCTTCCTACAGGGGAAGAGG + Exonic
1174478717 20:50815810-50815832 GAGGGAGCCTTCAGGTGCAGGGG + Intronic
1174505898 20:51017411-51017433 GAGGGTGCCTGGAAGGGCAGAGG + Intronic
1175547608 20:59788694-59788716 CAGGGCCTCTGCAGGGACAGTGG - Intronic
1175715786 20:61253305-61253327 GCGGGGCTCTGCAGAGGCAGCGG - Intronic
1175756513 20:61533583-61533605 GAGGGGCCCCTCATGGGCAGAGG - Intronic
1175935728 20:62513086-62513108 GAGGAGCTCTGCCGGGGCAGAGG + Intergenic
1176048483 20:63104607-63104629 GAGGGCTCCTGGGGGGGCAGGGG - Intergenic
1176066995 20:63203068-63203090 GAGGGTGCCTGCTGGGGGACTGG + Exonic
1176258739 20:64167691-64167713 CAGGGTGCCCGCAGGGGCTGGGG + Intronic
1177394083 21:20510839-20510861 GAAGTTTGCTGCAGGGGCAGAGG - Intergenic
1178578444 21:33815823-33815845 GAGGGAGCCTGGAGGGGCTGCGG + Intronic
1179133061 21:38656052-38656074 TGGGGCCTCTGCAGGGGCAGTGG - Intronic
1179382468 21:40912071-40912093 GAGGGTCCCTGCTGCAGGAGTGG + Intergenic
1179515045 21:41900522-41900544 GAGGGCCCCTGGAGGGGCTCAGG + Intronic
1179826275 21:43968209-43968231 GGGGGTCCCTGCAGGGCTGGGGG + Intronic
1179930773 21:44569511-44569533 GAGGGTCCTGGCTGGGGCAGGGG + Intronic
1180086619 21:45510516-45510538 GAGGGGCACTGCCGGGGGAGCGG - Intronic
1180367848 22:11957023-11957045 GACTGGGCCTGCAGGGGCAGGGG - Intergenic
1180897962 22:19351100-19351122 GAGGCTGCCTGCAGGGGCTCTGG - Intronic
1181311908 22:21949479-21949501 GGGAGTGCCTGGAGGGGCAGGGG + Intronic
1181783940 22:25212351-25212373 GAGGTTCATGGCAGGGGCAGGGG + Intergenic
1182355317 22:29720189-29720211 CCGGGGCCCCGCAGGGGCAGCGG - Exonic
1183023378 22:35045239-35045261 GAGGGAGCCTGCAGGTGCAGAGG + Intergenic
1183249896 22:36723008-36723030 GAGGCTGCCTGCAGGGGCAGAGG - Intergenic
1183303368 22:37069399-37069421 GAGGGTCCCTGGATGGGGAGAGG - Intronic
1183317961 22:37147341-37147363 GAGGATCCCTGCCTGGGCACTGG - Intronic
1183321193 22:37166191-37166213 GAGGGTCCCCCCAGTAGCAGGGG - Intronic
1183321429 22:37167311-37167333 GAGGGTGCCGGCTGGGGCTGGGG - Intronic
1183361353 22:37384801-37384823 GAGGGGGCCAGCAGGGGCCGGGG - Intronic
1183420822 22:37710355-37710377 GAGGGGCTGTGCAGGGGGAGGGG + Intronic
1183455219 22:37918874-37918896 CAGGGCCCCAGGAGGGGCAGAGG - Intronic
1183975273 22:41508435-41508457 GAGGGTCCTTGGAGGGTCAGAGG - Intronic
1183977823 22:41523456-41523478 GAAGGGCCCTGCAGAGGCACTGG + Intronic
1183977947 22:41523982-41524004 GGGGGTCCCTGGCGGGTCAGAGG + Intronic
1184112668 22:42404361-42404383 GAGGCTCCCTCCAGGCACAGAGG - Intronic
1184272613 22:43393312-43393334 GAGGGGCCCAGCAGGGGAAAGGG - Intergenic
1184330597 22:43824774-43824796 GAGGGTCGCTGCTGTGGAAGGGG - Exonic
1184364997 22:44045127-44045149 AGGTGCCCCTGCAGGGGCAGGGG + Intronic
1184557548 22:45241205-45241227 GAGGTGCCCTGAAGGGGCGGCGG - Intergenic
1184679322 22:46061801-46061823 GAGGGTCCGGGCCGGGGCCGGGG - Intronic
1184701934 22:46180989-46181011 GACGGTTCCAGCAGGGGCTGGGG + Intronic
1184726266 22:46348463-46348485 TAGAGCACCTGCAGGGGCAGTGG + Intronic
1184782085 22:46654563-46654585 GGAGGTCCCTGCAGGGGGTGGGG + Intronic
1185051116 22:48554846-48554868 GAGTGTCTCTGCAGAGACAGTGG + Intronic
1185051368 22:48555938-48555960 GAGGGCCCTGGCTGGGGCAGGGG - Intronic
1185132634 22:49048065-49048087 GTGGCTCCCTGGAGGGGCTGTGG - Intergenic
1185384559 22:50525911-50525933 GGGGGTCCCTGCAGAGCGAGGGG + Exonic
1185409605 22:50674823-50674845 GAGGGTCCCGGCGGAGGCGGCGG - Intergenic
949903275 3:8837629-8837651 CAGGGTCCATCCAGGGGCAGAGG + Intronic
950451278 3:13067178-13067200 GAGGCTCCCTGCAGGCAGAGTGG - Intronic
950472403 3:13194255-13194277 GGGGGTGCCAGCAGAGGCAGGGG + Intergenic
950501331 3:13365750-13365772 GAGCCTCCCTGATGGGGCAGTGG - Intronic
950644900 3:14371328-14371350 GAGGGTCCCAGCTGAGGAAGAGG - Intergenic
952962121 3:38598865-38598887 GAGGGTACCTGCAGCGGAAGTGG + Intronic
953606159 3:44414689-44414711 GAGGGTCACTCCAGGGACAGTGG - Intergenic
953809195 3:46097363-46097385 GAGGGTCCCCGCAGTGGCTCCGG - Intergenic
954136339 3:48583835-48583857 GTGGGTCTCTCCTGGGGCAGTGG - Intronic
954638649 3:52085222-52085244 GAGGAGCCCAGCTGGGGCAGGGG - Intronic
955059818 3:55485124-55485146 GAGGGCCCCTGCTGGGAGAGTGG + Intronic
955200874 3:56851136-56851158 GGGTGTCCCTGCAGGCACAGAGG - Intronic
956420180 3:69079869-69079891 GAGGGCCCCTGCAGGAGCTGGGG + Intronic
957095219 3:75771833-75771855 GACTGAGCCTGCAGGGGCAGGGG - Intronic
957544769 3:81623258-81623280 TGAAGTCCCTGCAGGGGCAGTGG - Intronic
960393601 3:117109150-117109172 AAGGGTGCCTGCAGGGAAAGGGG - Intronic
960626504 3:119686771-119686793 GAAGTTTGCTGCAGGGGCAGGGG - Intergenic
961642242 3:128371830-128371852 GAGTGGTCCTGCAGGGGCCGGGG + Intronic
961795120 3:129403610-129403632 CAGCATCCCTGCAGAGGCAGGGG - Intronic
962010640 3:131387275-131387297 GAGGCTCCCTTTAGGGGTAGAGG + Intronic
962750969 3:138434667-138434689 GAGAGTCCCAGCAGGGCAAGGGG + Exonic
963827587 3:149971234-149971256 GAGGGTCCCGGGAAGGGCGGGGG + Intronic
964409693 3:156384854-156384876 GAGGGCACCTGAAGGGGTAGGGG + Intronic
965364678 3:167783987-167784009 GAGGGCCTCTGCCAGGGCAGTGG - Intronic
966803450 3:183786255-183786277 GAGGGCCACGGCAGGGGAAGTGG - Exonic
966915886 3:184583851-184583873 GAGGGGCTGTGCGGGGGCAGGGG + Intronic
966943312 3:184760328-184760350 GAGGGTGCTTCTAGGGGCAGGGG + Intergenic
967915621 3:194576161-194576183 AAGGCACCCTGCTGGGGCAGGGG - Intergenic
968048142 3:195635426-195635448 GGGGGTCCGGGCAGGGGCGGGGG - Intergenic
968099260 3:195954194-195954216 GGGGGTCCGGGCAGGGGCGGTGG + Intergenic
968107621 3:196013815-196013837 GAGGGGGCATGCAGGGGAAGGGG - Intergenic
968306469 3:197654495-197654517 GGGGGTCCGGGCAGGGGCGGGGG + Intergenic
968439001 4:612195-612217 GAAGGTCCTGGCAGGGGCTGTGG + Intergenic
968472174 4:787179-787201 GAGTGGCCCTGCTGGGGCCGCGG - Intronic
968520110 4:1031313-1031335 GAGGGTCTGTGCAGGGGCAGGGG + Intergenic
968521670 4:1037143-1037165 GAGGGCCCTGGGAGGGGCAGTGG + Intergenic
968542868 4:1177236-1177258 GGGGGTGCCTGCTGGGGCCGTGG - Intronic
968606445 4:1537889-1537911 GCAGGTCCATGCTGGGGCAGGGG + Intergenic
968701214 4:2059112-2059134 GAGGGGCCCGGCACGGGCGGGGG - Intergenic
968737209 4:2303701-2303723 GAGAGTCCTGGGAGGGGCAGAGG + Intronic
968842392 4:3017031-3017053 GAGGGTGCAGGCAGGGGCAGAGG - Intronic
968936926 4:3616013-3616035 CGGGGTCCCTTTAGGGGCAGGGG + Intergenic
969234244 4:5854053-5854075 GAGGGTCTCTGGAGTGGCAGTGG - Intronic
969568830 4:7996072-7996094 GAGGGCCCCTCCAGCTGCAGCGG + Intronic
969680297 4:8639645-8639667 CAGAGCCCCTGCAGGGGCCGAGG - Intergenic
973713284 4:53650362-53650384 GAGGGCATCTGCATGGGCAGGGG + Intronic
975650502 4:76588421-76588443 GAGGGTCCCTACTGGTGCTGTGG + Intronic
976273517 4:83252972-83252994 GAGGGACCCTGCAGGAGGAAAGG - Intergenic
981359639 4:143831672-143831694 GAAGTTTGCTGCAGGGGCAGAGG + Intergenic
981370400 4:143952745-143952767 GAAGTTTGCTGCAGGGGCAGAGG + Intergenic
981380158 4:144062669-144062691 GAAGTTTGCTGCAGGGGCAGAGG + Intergenic
982459901 4:155656180-155656202 GAAGACACCTGCAGGGGCAGAGG + Intergenic
984938601 4:184911823-184911845 GAGGGTCCCCACAGGAGCTGGGG - Intergenic
985070006 4:186158478-186158500 CAGGGTCTCTGCAGAAGCAGAGG - Intronic
985286026 4:188337008-188337030 GCGGGTCCCTGCAGGGCGACTGG + Intergenic
985448087 4:190038479-190038501 GTGGCCCCCTCCAGGGGCAGGGG - Intergenic
985488132 5:163192-163214 CAGGGGCCTTCCAGGGGCAGGGG + Exonic
985548254 5:520688-520710 GTGGGTCCCTGGGGAGGCAGAGG - Intronic
985570829 5:643871-643893 GGGGGTTCCTGCAGGGCCACCGG + Intronic
985668737 5:1195636-1195658 GGAGGACCCTGCAGGGTCAGAGG + Intergenic
988358347 5:30204553-30204575 AAGGGGCCCTGCAGTGGCAGTGG - Intergenic
992042414 5:72848652-72848674 GAGTCGCCCGGCAGGGGCAGCGG - Intronic
992069613 5:73136731-73136753 GAGAGCCTCTGCAGGGGCTGAGG + Intergenic
993703435 5:91144059-91144081 GAGCGGGCCTGCAGGGGCAGTGG + Intronic
994124723 5:96155960-96155982 GAGGGGCCCTGCAATAGCAGAGG + Intergenic
994234237 5:97342772-97342794 GAAGTTTGCTGCAGGGGCAGAGG - Intergenic
995724530 5:115169706-115169728 GCGGGTCCCTGCGGCGGCCGTGG + Intronic
997525742 5:134552165-134552187 GCAGGTGCCTGCCGGGGCAGAGG + Exonic
997885390 5:137625525-137625547 CAGGGTTCGGGCAGGGGCAGGGG + Intronic
999179387 5:149658377-149658399 GACAGTCCCTGCAGGGACAGGGG - Intergenic
1000097726 5:157986260-157986282 CAGGGTCCGGGGAGGGGCAGAGG - Intergenic
1000188854 5:158888782-158888804 GAGTGTTCCTGGAGTGGCAGAGG - Intronic
1001585890 5:172833840-172833862 GAGAGACACGGCAGGGGCAGAGG + Intergenic
1001673279 5:173491954-173491976 GGTGCTTCCTGCAGGGGCAGCGG + Intergenic
1002133582 5:177095518-177095540 CAGGGGCCCTGCAGAGGGAGTGG - Exonic
1002168393 5:177361977-177361999 CAGGGGCCCTGCAGGGGCTCTGG - Intronic
1002180963 5:177431002-177431024 GAGGGGCCCTGCTGGGGCCGGGG + Intronic
1002206163 5:177563977-177563999 CAGAATCCCTGTAGGGGCAGTGG + Intergenic
1002261344 5:177995780-177995802 GTGGGTCCCTGAGGAGGCAGCGG - Intronic
1002372844 5:178768770-178768792 GAGGCCCCGTGCAGGGGTAGGGG - Intergenic
1003094761 6:3133515-3133537 GAGGGGACCTGGAGAGGCAGAGG - Intronic
1003097804 6:3156381-3156403 GAGGGGCCCTGGAGGAGGAGGGG + Intronic
1003101534 6:3179939-3179961 GAGGGGCCCTGGAGGAGGAGGGG + Intergenic
1003119516 6:3308261-3308283 GAGGGTGAGTGCAGGGGCACTGG - Intronic
1003530816 6:6936193-6936215 GAGTGTGCCCGGAGGGGCAGAGG - Intergenic
1005913985 6:30335982-30336004 GAGGGGCTATGCAGGGGCAAAGG - Intronic
1006180681 6:32151847-32151869 CAGGGTCCCTGCAGCCGGAGTGG + Exonic
1006188206 6:32192155-32192177 GCGGGTCCCTGGAGGAGGAGGGG + Exonic
1006408743 6:33859867-33859889 GAGGGTGGCTGCAGGCACAGTGG + Intergenic
1006520015 6:34565889-34565911 GTGGGGCCCTGCACGGGGAGAGG - Intergenic
1006921990 6:37633335-37633357 GAGAGTCCCTGCAGAGCCACTGG - Exonic
1007072607 6:39048434-39048456 GAGGGACCCTGAATGGGCGGGGG + Intergenic
1007400477 6:41599849-41599871 GAGGGTGACTGCAGAGGAAGGGG - Exonic
1008485185 6:52027821-52027843 GTGGGTCCCTGCTGGGTGAGTGG - Exonic
1015785775 6:136921284-136921306 GAGTCTCCCTGCAGGGTGAGGGG + Intergenic
1017493050 6:154960639-154960661 GAGGAGCACTGCAGGGACAGAGG - Intronic
1018688640 6:166324407-166324429 GACAGGCCCTGCAGGGTCAGAGG - Intronic
1018728158 6:166629053-166629075 GAGGGTCCCAGCAGGGATACAGG - Intronic
1018862321 6:167720125-167720147 GCGGGCTCCTGCAGAGGCAGAGG - Intergenic
1018908645 6:168089372-168089394 GAGAGTCCCTCCAGGGCCACGGG - Intergenic
1019158405 6:170053676-170053698 GAGGGCTCCAGCTGGGGCAGAGG + Intergenic
1019430616 7:997325-997347 GAGGGTCCCTCCAAGGCCAGGGG + Exonic
1019504448 7:1383829-1383851 GACTGTTCCTGCTGGGGCAGGGG - Intergenic
1021609541 7:22444107-22444129 AAGGATCCCTGCAGAGGGAGTGG + Intronic
1021929618 7:25566912-25566934 GAGGGTCTTTGCAGGCACAGAGG - Intergenic
1023337737 7:39187543-39187565 GAGGGCCGCTGAAGGGGCCGGGG + Intronic
1023821246 7:43981790-43981812 GAGGGGCCCCGCAGGAGCAGGGG - Intergenic
1023966742 7:44966831-44966853 AAGGGCTCCTGCAGGGACAGAGG + Exonic
1024231723 7:47368373-47368395 GAGGGCCCCAGCAGGGCCACCGG - Exonic
1024987929 7:55212117-55212139 GTGGGTCCCAGCATGGGCAAGGG + Intronic
1025035289 7:55589807-55589829 CAGGCTCCCTGCAGGGTAAGGGG - Intergenic
1025635653 7:63317548-63317570 GAGGGTCTGGGGAGGGGCAGTGG - Intergenic
1025647043 7:63430632-63430654 GAGGGTCTGGGGAGGGGCAGTGG + Intergenic
1028918107 7:96281990-96282012 GAGGGTCCCTATAGGGGGAACGG + Intronic
1029441806 7:100590854-100590876 GGGGATCCCTGGAGGGGAAGAGG - Intronic
1029749515 7:102535214-102535236 GAGGGGCCCCGCAGGAGCAGGGG - Intergenic
1029767463 7:102634317-102634339 GAGGGGCCCCGCAGGAGCAGGGG - Intronic
1032084407 7:128876564-128876586 GTGGGATCCTGCAGGGGCTGAGG - Intronic
1033551535 7:142452048-142452070 AAGGCTCCATGCAAGGGCAGAGG - Intergenic
1035037960 7:155907646-155907668 TAGGGTCCATCCTGGGGCAGGGG + Intergenic
1035222140 7:157412328-157412350 GAGCGAGCCTGCAGGGGCGGAGG - Intronic
1035460808 7:159037358-159037380 CAGGGGCCCTGCAGGGGCCCAGG + Intronic
1036765703 8:11548146-11548168 GGGGGGTCCTGCAGGGACAGGGG - Intronic
1037885334 8:22593198-22593220 AGGGGTCCCAGCAGTGGCAGCGG + Intronic
1038478741 8:27886940-27886962 GAGGGTCCCTGCAGGGGGAACGG + Intronic
1038493453 8:27985849-27985871 GAGGGGCCCAGAAGGCGCAGTGG + Intronic
1039371231 8:36986087-36986109 GAGAGTGTTTGCAGGGGCAGAGG - Intergenic
1039846248 8:41327810-41327832 GTGGGTCCCAGGAGGGGCGGGGG - Intergenic
1039919598 8:41883935-41883957 GAGTGGCACTGGAGGGGCAGAGG + Intronic
1040303378 8:46199677-46199699 GAGGCTCCCTGCAGTGTCACCGG - Intergenic
1040452434 8:47561657-47561679 GAGGATCCCAGGAGGGGCAGGGG - Intronic
1041081403 8:54218302-54218324 CAGGGTCCCTCGAGGTGCAGAGG + Intergenic
1041582489 8:59477546-59477568 GAGGGCCATGGCAGGGGCAGTGG + Intergenic
1041868341 8:62603409-62603431 GAAGTGCCCTGCAGGAGCAGAGG + Intronic
1042762481 8:72285963-72285985 GAGGGTCCCAGTAGGGGCAGCGG + Intergenic
1043357993 8:79436256-79436278 GAGGATCCCTGAAAGGCCAGAGG - Intergenic
1049215215 8:141404686-141404708 GAGCATCTCTGCAGAGGCAGGGG + Intronic
1049398709 8:142415220-142415242 GAGGGGCCCTCCTGGGGCTGTGG + Intergenic
1049425851 8:142537570-142537592 GAGTCACCCTGCAGGGGCTGAGG - Intronic
1049476754 8:142800441-142800463 GAGGCTCTCTGCAGAGGCAGTGG - Intergenic
1049614114 8:143568889-143568911 GAGAGCCCCTGCAGGGGGTGGGG + Intronic
1049705789 8:144041381-144041403 CAGGGGTCCTGCAGGGACAGGGG + Intronic
1049905778 9:215090-215112 GAGCTTCGCTGCAGGGGCCGAGG + Exonic
1050305308 9:4299907-4299929 GGGGGTCCCGGGAGGGGCAGTGG + Exonic
1050935755 9:11392857-11392879 GACGTTTGCTGCAGGGGCAGAGG + Intergenic
1051343216 9:16129904-16129926 GAGGGCCCCTGCTGGGGCTATGG + Intergenic
1052832274 9:33225948-33225970 GAGGGAACCTTCTGGGGCAGTGG - Intronic
1052840545 9:33288828-33288850 AGGGGTCTCTCCAGGGGCAGGGG + Intergenic
1053003749 9:34591396-34591418 GAGCTTCGCCGCAGGGGCAGGGG - Intergenic
1053162609 9:35824053-35824075 GAGGGTCCCTGCATGGGAAAGGG + Intronic
1053307218 9:36993564-36993586 AAGGGACACAGCAGGGGCAGGGG + Intronic
1053406354 9:37879807-37879829 GAGGGCACCTGCATGGGCAGAGG + Intronic
1054814670 9:69463731-69463753 GGGGGTCCCTGCAGGGAGTGAGG + Intronic
1056655553 9:88505850-88505872 GAGGGTCTCTGCCGGGGCTGCGG + Intergenic
1056827574 9:89887427-89887449 GAGCGTCCTTCCAGAGGCAGAGG - Intergenic
1056838119 9:89974427-89974449 CAGGTGCCCTGCAGGGACAGTGG + Intergenic
1057744608 9:97741307-97741329 GACTGTCCCGGCAGGGGCGGAGG - Intergenic
1058313636 9:103536285-103536307 GAGTGTCACTGCAGGTGCAATGG - Intergenic
1058604665 9:106707607-106707629 AAGGGACCCTGCAAGGACAGTGG - Intergenic
1058729789 9:107838787-107838809 GAGAGTCTGTGAAGGGGCAGGGG + Intergenic
1059432747 9:114259952-114259974 GAGGGACCCTGCTGGGCCACAGG - Intronic
1060544297 9:124451290-124451312 CAGGGTCCCTGCAGCGGGTGGGG - Intergenic
1060544925 9:124453983-124454005 GAGGGCACTGGCAGGGGCAGGGG - Exonic
1061331349 9:129896197-129896219 GAGGGTCCCTAGAGAGACAGAGG - Intronic
1061383727 9:130276097-130276119 GGAGGTCCCTGGAGGGGCAGGGG + Intergenic
1061434440 9:130552172-130552194 GAGGATCCCTGTGGGGGAAGTGG + Intergenic
1061500064 9:130997038-130997060 GAGGGTCTCCGGAGGGGAAGTGG - Intergenic
1061834327 9:133318651-133318673 GAGGGACCCTGAGGGGGCAAAGG + Intergenic
1061878045 9:133554663-133554685 GAGGGGCCCCCCAGGGGCAAGGG + Exonic
1062010856 9:134265931-134265953 GGGGCTCCCTGGAGGGGCAGGGG - Intergenic
1062023773 9:134331148-134331170 GAGGGTCCCTGGAGTGGCACAGG - Intronic
1062047013 9:134429027-134429049 TAGGGTCCCACCAGGGGCTGGGG + Intronic
1062086912 9:134653768-134653790 GGGGGTGTCTGCAGGGTCAGGGG + Intronic
1062238134 9:135522347-135522369 GAGGGGCCCTGAGGGGGCAGAGG + Intronic
1062291432 9:135797010-135797032 GAGGCTCCGGGCAGGTGCAGGGG - Intergenic
1062365144 9:136204853-136204875 GGGGGTGCGTGCAGGGCCAGCGG - Intronic
1185445380 X:255113-255135 GAGAGTCCCTCCTGGGGCCGCGG + Intergenic
1185451080 X:280959-280981 GGGGGGCCGTGCAGGGGGAGGGG + Intronic
1185451153 X:281117-281139 GGGGGGCCGTGCAGGGGGAGGGG + Intronic
1185463297 X:342067-342089 GATGGGCCGTGCAGGGGCATCGG - Intronic
1185519053 X:724713-724735 GAGGGTCACTGCAGGTGGTGAGG - Intergenic
1185519083 X:724840-724862 GAGGGTCCCTGCAGGTGGTCAGG - Intergenic
1185519121 X:725009-725031 GAGGGTCCCTGCAGGTGGTCAGG - Intergenic
1185519160 X:725177-725199 GAGGGTCCCTGCAGGTGGTCAGG - Intergenic
1185519181 X:725261-725283 GAGGGTCCCTGCAGGTGGTCAGG - Intergenic
1187820544 X:23283344-23283366 GAGGGTCTCTGCAGCTGAAGAGG + Intergenic
1189352005 X:40282678-40282700 GATTGCCCCTGCAGGGGCAGAGG - Intergenic
1190123752 X:47685310-47685332 GAGGATCCCTGCAGGTGCTAAGG - Intergenic
1190124066 X:47687685-47687707 AAGGGTCCCTGCTGGGGTGGGGG - Intergenic
1193028747 X:76875039-76875061 GAGTTTCACTGCAGAGGCAGTGG - Intergenic
1193078736 X:77383194-77383216 GAGGTTCCAGGCAGGTGCAGAGG - Intergenic
1199216528 X:145265702-145265724 GAATATCCCTGCAGGGGCAGGGG + Intergenic
1199760110 X:150898677-150898699 GCGGGACCCTGCAGAGGCGGCGG - Exonic
1200308112 X:155049211-155049233 GAGGGACCTTGCAGCGGGAGAGG + Intronic
1200745047 Y:6896886-6896908 GAGGTCCCAAGCAGGGGCAGTGG + Intergenic
1200876054 Y:8155757-8155779 GTGGGTGCCTGTAGTGGCAGTGG - Intergenic
1201161689 Y:11172140-11172162 GAGGGTCCGTTCAGGGGCCATGG - Intergenic