ID: 938371147

View in Genome Browser
Species Human (GRCh38)
Location 2:130768965-130768987
Sequence TTCCCAGCACAACGTGGCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 140}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938371147_938371157 6 Left 938371147 2:130768965-130768987 CCACTGCCACGTTGTGCTGGGAA 0: 1
1: 0
2: 0
3: 11
4: 140
Right 938371157 2:130768994-130769016 AACATTGGGTAGGGCCAGGAGGG 0: 1
1: 0
2: 1
3: 19
4: 255
938371147_938371152 -8 Left 938371147 2:130768965-130768987 CCACTGCCACGTTGTGCTGGGAA 0: 1
1: 0
2: 0
3: 11
4: 140
Right 938371152 2:130768980-130769002 GCTGGGAAGCTGGGAACATTGGG 0: 1
1: 0
2: 2
3: 24
4: 266
938371147_938371159 14 Left 938371147 2:130768965-130768987 CCACTGCCACGTTGTGCTGGGAA 0: 1
1: 0
2: 0
3: 11
4: 140
Right 938371159 2:130769002-130769024 GTAGGGCCAGGAGGGAGAGAGGG 0: 1
1: 0
2: 11
3: 102
4: 1156
938371147_938371151 -9 Left 938371147 2:130768965-130768987 CCACTGCCACGTTGTGCTGGGAA 0: 1
1: 0
2: 0
3: 11
4: 140
Right 938371151 2:130768979-130769001 TGCTGGGAAGCTGGGAACATTGG 0: 1
1: 0
2: 2
3: 114
4: 2080
938371147_938371154 -3 Left 938371147 2:130768965-130768987 CCACTGCCACGTTGTGCTGGGAA 0: 1
1: 0
2: 0
3: 11
4: 140
Right 938371154 2:130768985-130769007 GAAGCTGGGAACATTGGGTAGGG 0: 1
1: 0
2: 2
3: 24
4: 200
938371147_938371164 29 Left 938371147 2:130768965-130768987 CCACTGCCACGTTGTGCTGGGAA 0: 1
1: 0
2: 0
3: 11
4: 140
Right 938371164 2:130769017-130769039 AGAGAGGGAAGAGGACAGGGAGG 0: 1
1: 0
2: 27
3: 341
4: 3249
938371147_938371153 -4 Left 938371147 2:130768965-130768987 CCACTGCCACGTTGTGCTGGGAA 0: 1
1: 0
2: 0
3: 11
4: 140
Right 938371153 2:130768984-130769006 GGAAGCTGGGAACATTGGGTAGG 0: 1
1: 1
2: 6
3: 40
4: 301
938371147_938371163 26 Left 938371147 2:130768965-130768987 CCACTGCCACGTTGTGCTGGGAA 0: 1
1: 0
2: 0
3: 11
4: 140
Right 938371163 2:130769014-130769036 GGGAGAGAGGGAAGAGGACAGGG 0: 1
1: 3
2: 74
3: 512
4: 3594
938371147_938371156 5 Left 938371147 2:130768965-130768987 CCACTGCCACGTTGTGCTGGGAA 0: 1
1: 0
2: 0
3: 11
4: 140
Right 938371156 2:130768993-130769015 GAACATTGGGTAGGGCCAGGAGG 0: 1
1: 0
2: 2
3: 12
4: 197
938371147_938371158 13 Left 938371147 2:130768965-130768987 CCACTGCCACGTTGTGCTGGGAA 0: 1
1: 0
2: 0
3: 11
4: 140
Right 938371158 2:130769001-130769023 GGTAGGGCCAGGAGGGAGAGAGG 0: 1
1: 0
2: 11
3: 129
4: 1094
938371147_938371155 2 Left 938371147 2:130768965-130768987 CCACTGCCACGTTGTGCTGGGAA 0: 1
1: 0
2: 0
3: 11
4: 140
Right 938371155 2:130768990-130769012 TGGGAACATTGGGTAGGGCCAGG 0: 1
1: 0
2: 1
3: 26
4: 232
938371147_938371162 25 Left 938371147 2:130768965-130768987 CCACTGCCACGTTGTGCTGGGAA 0: 1
1: 0
2: 0
3: 11
4: 140
Right 938371162 2:130769013-130769035 AGGGAGAGAGGGAAGAGGACAGG 0: 1
1: 1
2: 73
3: 575
4: 4359
938371147_938371161 20 Left 938371147 2:130768965-130768987 CCACTGCCACGTTGTGCTGGGAA 0: 1
1: 0
2: 0
3: 11
4: 140
Right 938371161 2:130769008-130769030 CCAGGAGGGAGAGAGGGAAGAGG 0: 1
1: 0
2: 39
3: 557
4: 3123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938371147 Original CRISPR TTCCCAGCACAACGTGGCAG TGG (reversed) Intergenic
900393776 1:2444821-2444843 TCCCCAGACCAACGTGTCAGGGG - Intronic
901562961 1:10087648-10087670 TTCCCATCACATCGTATCAGGGG + Intronic
901674950 1:10877734-10877756 ATCCCAGCAGAAGGTTGCAGGGG - Intergenic
903219659 1:21862091-21862113 ATGCCAGCACAACGCCGCAGGGG - Exonic
904601952 1:31678155-31678177 CTCCCAGCCCACGGTGGCAGGGG + Intronic
905930431 1:41783113-41783135 TTCCCAGGAGAACTTAGCAGGGG - Intronic
906145623 1:43558505-43558527 TGCCCAGCACAAGCTGGCCGGGG + Intronic
907573339 1:55504255-55504277 TGTCCAGCACAGCCTGGCAGAGG + Intergenic
909521821 1:76577318-76577340 TTCCAAGCAGAAAGAGGCAGTGG - Intronic
910665056 1:89715922-89715944 TTCTCAGCACAGTGTGGCAGTGG + Exonic
917730425 1:177870000-177870022 TTCCCAGCAAGACATGCCAGAGG + Intergenic
919923194 1:202178316-202178338 TGCCCAGCACAGCGAGGCTGAGG - Intergenic
922787826 1:228291952-228291974 TTCACACCACAACATGGCTGTGG - Exonic
923128844 1:231057318-231057340 TTCCCATCCCCACGTGTCAGGGG - Intergenic
924078277 1:240363915-240363937 TTACCCACACAAAGTGGCAGAGG - Intronic
1064599873 10:16982641-16982663 ATCCCACCACAACCTGGAAGTGG + Exonic
1064777184 10:18792039-18792061 GTCCCAGCCCCACGTGGCTGGGG + Intergenic
1065742933 10:28813302-28813324 TACCTAGCACAAAGTTGCAGGGG - Intergenic
1067289850 10:44932764-44932786 TTTCAAGCACAGCTTGGCAGTGG - Intronic
1070690465 10:78521237-78521259 TCCCAAGCACTAGGTGGCAGGGG - Intergenic
1073802846 10:107062344-107062366 TTTCAACCACAACATGGCAGAGG + Intronic
1076143902 10:128101449-128101471 CTCCCAGCCTAAGGTGGCAGAGG - Exonic
1077675464 11:4190510-4190532 TTCCAAGGACAAGGTGGCTGGGG - Intergenic
1081804464 11:45882934-45882956 TTCCCAGATCAACCTGCCAGTGG + Exonic
1083675509 11:64322768-64322790 TTCCCTGCACCAAGGGGCAGAGG - Intergenic
1091660675 12:2380953-2380975 TTCCCAGCAGCACGTGGGATGGG + Intronic
1093242258 12:16691768-16691790 ATCCCAGCACAACCTGACAGAGG + Intergenic
1097079936 12:56422532-56422554 TTCCCAGCACATTTTGGGAGAGG + Intronic
1098770859 12:74551416-74551438 TTACCACCAGAACATGGCAGGGG - Intergenic
1098898119 12:76085045-76085067 TTCCCAGCACAACGCCGAAGGGG - Intergenic
1100207958 12:92371513-92371535 ATCCCAGTACAATGTGGAAGGGG - Intergenic
1102604060 12:114055272-114055294 TTCCCACTACGAAGTGGCAGGGG - Intergenic
1103047828 12:117752917-117752939 TTCCCCCAACAACGTGGCTGTGG + Intronic
1104161581 12:126186335-126186357 GTCACAGGACAACGGGGCAGAGG + Intergenic
1105171838 13:17603526-17603548 TTCCCAGAAAAACGAGACAGAGG + Intergenic
1105194855 13:17961149-17961171 TTCCCAGAAAAACGAGACAGAGG + Intergenic
1111351218 13:87034126-87034148 GATCCAGCAAAACGTGGCAGAGG - Intergenic
1113036089 13:106050886-106050908 TTACTTGGACAACGTGGCAGTGG - Intergenic
1115498616 14:34030014-34030036 TTTCCAGCACAAGGAGGCAGCGG + Intronic
1118063228 14:62163517-62163539 TTCTCAGGTCAACCTGGCAGGGG + Intergenic
1118915568 14:70100291-70100313 TTCCCAGGACAACTGGGCCGAGG - Intronic
1119939384 14:78624555-78624577 TTCCCAACAAAAGATGGCAGAGG - Intronic
1122995399 14:105261162-105261184 CACCCGGCACAGCGTGGCAGGGG - Intronic
1128111513 15:65079135-65079157 TTGCCATCACCACGGGGCAGTGG + Intergenic
1128115244 15:65101235-65101257 TTGGCAGCAGAAGGTGGCAGCGG - Intronic
1128752738 15:70160852-70160874 TTCCCGGTACAACGTGCCAATGG - Intergenic
1130703203 15:86206636-86206658 ATCCCATCACAAAGTGGGAGAGG - Intronic
1132467190 16:82781-82803 TTCCCAGCCCAGCCTGGCTGTGG + Intronic
1133023623 16:2977856-2977878 CTCCCAGCTCCACATGGCAGAGG + Intronic
1135912781 16:26576773-26576795 TTCCCACCACAACCTTGCGGAGG + Intergenic
1139176913 16:64700468-64700490 TTCCCAGTATAACATGGCACTGG + Intergenic
1139591269 16:67934643-67934665 TTCCAGGCACAAAGTGGTAGCGG + Exonic
1141037770 16:80643384-80643406 TGCCCAGCACAAGCTGTCAGTGG + Intronic
1141160280 16:81625168-81625190 CTCCCAGACCAACATGGCAGAGG - Intronic
1141516012 16:84545562-84545584 CTTCCAGCACAGCATGGCAGGGG - Intronic
1146804668 17:35855738-35855760 TCCCCAGGACACCCTGGCAGAGG + Exonic
1147992966 17:44346161-44346183 TTCCCAGCAAGCCATGGCAGCGG + Intronic
1150346007 17:64405246-64405268 TTCCCAGCCCACAGTGACAGAGG - Intronic
1154502736 18:15004699-15004721 TACCCAGCACACCCTGGCCGTGG + Intergenic
1154675985 18:17403978-17404000 TTCCCATAACAACTAGGCAGAGG + Intergenic
1154686262 18:17544747-17544769 TTCCCATAACAACTAGGCAGAGG + Intergenic
1154795215 18:19039240-19039262 TTCCCATAACAACTAGGCAGAGG + Intergenic
1154827196 18:19479857-19479879 TTCCCATAACAACTAGGCAGAGG + Intergenic
1160794862 19:940664-940686 TTCCGAGCACACAGAGGCAGCGG + Intronic
1163694836 19:18758871-18758893 TTCCCAGATCATGGTGGCAGGGG - Intronic
1167415622 19:49370004-49370026 TTTCAAGGACAACCTGGCAGGGG + Intronic
1167521732 19:49959517-49959539 GACCCAGCTCAGCGTGGCAGGGG + Exonic
1167523651 19:49971205-49971227 GACCCAGCTCAGCGTGGCAGGGG - Intergenic
925626470 2:5846471-5846493 TTCCCAGCTCATCCTGCCAGGGG + Intergenic
926621388 2:15049639-15049661 TTCCCAGCCCAGAGGGGCAGGGG + Intergenic
928600938 2:32903067-32903089 GTCCCATCACAAAGTGTCAGTGG + Intergenic
935811847 2:106806142-106806164 TTCCCAGCACATCCTGGCAAAGG - Exonic
936115359 2:109698108-109698130 ATCCCAGCACAAGGAGGCTGAGG - Intergenic
938371147 2:130768965-130768987 TTCCCAGCACAACGTGGCAGTGG - Intergenic
938501903 2:131834867-131834889 TACCCAGCACACCCTGGCCGTGG + Intergenic
938566709 2:132525181-132525203 ATCCCAGCTCAAGGTGACAGTGG - Intronic
942071640 2:172321465-172321487 TTCTCAGCACAATGTTGCAATGG - Intergenic
946856444 2:223954788-223954810 ATCCCAGCACAATGTGAGAGGGG + Intergenic
947845008 2:233236860-233236882 TTCCCAGCTCCATGTGGCTGAGG - Intronic
948045255 2:234938804-234938826 ATCCCAGCAAAACTTGGCTGAGG - Intergenic
1173013283 20:39201628-39201650 TTTCAAGTACAACATGGCAGTGG - Intergenic
1175675778 20:60945615-60945637 TTCCCAGGCCAATGGGGCAGTGG - Intergenic
1176075338 20:63245660-63245682 TCCCCAGCACAGCTGGGCAGAGG + Intronic
1176230531 20:64030434-64030456 TCCCCAGCACTGGGTGGCAGTGG + Intronic
1176303874 21:5113525-5113547 TTCCCAGCACGCCCTGGCTGAGG - Intergenic
1176626012 21:9092431-9092453 TTCCTGGCACAACCTTGCAGAGG + Intergenic
1177266886 21:18797557-18797579 CTCCCAGCTCCACGTGGCTGGGG - Intergenic
1178771588 21:35509723-35509745 TTCACAGTACAAGGTGGCAGAGG - Intronic
1179853156 21:44148425-44148447 TTCCCAGCACGCCCTGGCTGAGG + Intergenic
1180022810 21:45139590-45139612 TTCCCTGCCCCACGTGACAGAGG - Intronic
1181580521 22:23825518-23825540 TTCGCAGCACAATCTGGCTGGGG + Intronic
1181921901 22:26327100-26327122 CTCCCAGCAGAAGCTGGCAGTGG - Intronic
1183984384 22:41561594-41561616 TTCCCAGCCCAACATTCCAGGGG - Intronic
1184355792 22:43978774-43978796 TTCCCAGCACCCAGTGGCTGGGG + Intronic
1185332894 22:50259558-50259580 ATCCCAGCACAGCGGGGCGGTGG + Intronic
950886787 3:16369290-16369312 ATCCCAGCAAAACCTGGCAGGGG - Intronic
954489193 3:50885689-50885711 CTCCCACCACACAGTGGCAGTGG - Intronic
954659248 3:52218151-52218173 TTCCCAGCACAAGGAAGTAGAGG - Intergenic
957210768 3:77255426-77255448 ATACCACCACAAGGTGGCAGTGG - Intronic
959369216 3:105502699-105502721 TTCCCTGCACAGGGAGGCAGTGG - Intronic
962769626 3:138600454-138600476 TTCTCAGCACAAGGAGGCTGTGG - Intergenic
965845042 3:172951680-172951702 AGCCCAGCACAAGCTGGCAGAGG - Intronic
968480823 4:832338-832360 GTCCCAGCACACAGTGGCAAAGG + Intergenic
969686005 4:8674673-8674695 TTCCCAGAAGAAGCTGGCAGAGG - Intergenic
974853739 4:67434151-67434173 TTCCCAGTTCCACGTGGCTGGGG - Intergenic
976513313 4:85935242-85935264 TTCCCAGCACCACTTGGTAGAGG - Intronic
977379157 4:96248384-96248406 TTGTCAGCACAACGTAGCCGAGG - Intergenic
981666666 4:147234976-147234998 TGCCCAGCACCACCTGGAAGAGG + Intergenic
984981305 4:185284612-185284634 TTCCCTTCACAACTTGGCACTGG - Intronic
990039171 5:51358287-51358309 TCCCCAGCAGAACTTGACAGGGG - Intergenic
992396300 5:76372349-76372371 TTCCCTTCAAAGCGTGGCAGTGG - Intergenic
992826412 5:80554081-80554103 TTCACAGCTCCACGTGGCTGGGG - Intergenic
995674835 5:114651777-114651799 TTCCCAGTACAAAGTGGGATTGG - Intergenic
997836078 5:137194545-137194567 TGCCCAGCATAGCGTGGCACAGG - Intronic
999434248 5:151550775-151550797 TCCCCAGGACACCGTGCCAGGGG - Exonic
1001287372 5:170433857-170433879 TTCACAGCTCATCGGGGCAGTGG + Intronic
1003035615 6:2638326-2638348 TTCCCAGCTCCACACGGCAGTGG + Intergenic
1003127042 6:3363713-3363735 TTCTCTCCAGAACGTGGCAGCGG - Intronic
1003573068 6:7268646-7268668 TTCCAACCATCACGTGGCAGGGG + Intronic
1006073475 6:31513932-31513954 GTCCCTGCACAAAGTGGCCGTGG + Intergenic
1006911946 6:37569136-37569158 TGGCCAGCACATCCTGGCAGAGG - Intergenic
1007177191 6:39905082-39905104 TTGCCAGCACACCTTGGCATAGG + Exonic
1008558269 6:52696629-52696651 TTCCCTCCACAAGGTGGAAGTGG - Intergenic
1009545877 6:65019821-65019843 TTCACAGTTCAACGTGGCTGGGG + Intronic
1010059874 6:71610429-71610451 TTCCCAGCACGCAGTGGAAGAGG - Intergenic
1012762699 6:103321750-103321772 TTGCCAGCACTACGTGGATGGGG - Intergenic
1017363479 6:153604387-153604409 TTACCATCACAACTTGGCAGGGG + Intergenic
1019424663 7:968633-968655 TTCGCAGCACAGCCTGGCAGGGG - Exonic
1019748054 7:2711669-2711691 ATCCCAGCACAGGGAGGCAGAGG - Intronic
1023139932 7:37091746-37091768 CTCACAGCACCACGTGGCTGGGG + Intronic
1027389666 7:77692403-77692425 TAACCAGCAAAACTTGGCAGTGG - Intergenic
1030432621 7:109469968-109469990 TTCCCAGGAAAACCTGGTAGGGG - Intergenic
1033780702 7:144665566-144665588 TTCCTAGAAGAACGTGGTAGCGG + Intronic
1034299721 7:150004924-150004946 ATCCCAGACCAAGGTGGCAGTGG + Intergenic
1034621852 7:152463231-152463253 CTCCCAGCAAAACAAGGCAGAGG - Intergenic
1034806329 7:154092379-154092401 ATCCCAGACCAAGGTGGCAGTGG - Intronic
1036968752 8:13330321-13330343 AACCCAGCACAACCTGGCAGAGG + Intronic
1039671226 8:39601284-39601306 CTTCCAGCCCAATGTGGCAGGGG + Intronic
1042533753 8:69839138-69839160 TTTCCAGGCCAAGGTGGCAGTGG - Intergenic
1044666853 8:94640879-94640901 TTCAAACCACGACGTGGCAGCGG - Intergenic
1049711181 8:144064074-144064096 TTCCAACCACCCCGTGGCAGAGG + Intergenic
1060438215 9:123614612-123614634 TTCCCAAGACAAAGTGGGAGGGG + Intronic
1060536406 9:124392489-124392511 TTCCCCGCACAAGAGGGCAGGGG + Intronic
1061410042 9:130415618-130415640 ATCTCAGCAAAACGTGGCTGTGG + Intronic
1061943552 9:133895510-133895532 TTCTCACCGCAACGTGCCAGCGG + Intronic
1062274967 9:135726241-135726263 TCCACAGCACTACGTGGCACAGG + Intronic
1062497544 9:136838801-136838823 TACCCAGCACACCCTGGCCGTGG - Intronic
1203655628 Un_KI270752v1:21501-21523 GTCCCAGCACTAGGAGGCAGAGG - Intergenic
1187912618 X:24124907-24124929 TTCCCAGCACAACCTAAAAGTGG + Intergenic
1189986891 X:46561496-46561518 CTCCCAGCCTAAAGTGGCAGAGG - Intergenic
1190490563 X:50978823-50978845 TAACCAGAACAACGTGGCATTGG + Intergenic
1200056381 X:153463557-153463579 TTCCCAGCACAGTGGGCCAGGGG + Intronic