ID: 938371722

View in Genome Browser
Species Human (GRCh38)
Location 2:130772823-130772845
Sequence CCATAGGCACTGAGGTCAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938371722_938371727 0 Left 938371722 2:130772823-130772845 CCTATTGACCTCAGTGCCTATGG No data
Right 938371727 2:130772846-130772868 CCCAATATGTACAACATGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938371722 Original CRISPR CCATAGGCACTGAGGTCAAT AGG (reversed) Intergenic
No off target data available for this crispr