ID: 938375539

View in Genome Browser
Species Human (GRCh38)
Location 2:130803381-130803403
Sequence GACAGCTCTTGGCCTGCTAC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938375537_938375539 -2 Left 938375537 2:130803360-130803382 CCTCTGTGGATCTTTTTGAGAGA No data
Right 938375539 2:130803381-130803403 GACAGCTCTTGGCCTGCTACCGG No data
938375536_938375539 2 Left 938375536 2:130803356-130803378 CCATCCTCTGTGGATCTTTTTGA No data
Right 938375539 2:130803381-130803403 GACAGCTCTTGGCCTGCTACCGG No data
938375535_938375539 6 Left 938375535 2:130803352-130803374 CCTGCCATCCTCTGTGGATCTTT No data
Right 938375539 2:130803381-130803403 GACAGCTCTTGGCCTGCTACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938375539 Original CRISPR GACAGCTCTTGGCCTGCTAC CGG Intergenic
No off target data available for this crispr