ID: 938375902

View in Genome Browser
Species Human (GRCh38)
Location 2:130806464-130806486
Sequence CAGAGGAAGCAGAGGGGTGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938375897_938375902 -8 Left 938375897 2:130806449-130806471 CCAGGAAATGGAAGCCAGAGGAA No data
Right 938375902 2:130806464-130806486 CAGAGGAAGCAGAGGGGTGCCGG No data
938375896_938375902 -7 Left 938375896 2:130806448-130806470 CCCAGGAAATGGAAGCCAGAGGA No data
Right 938375902 2:130806464-130806486 CAGAGGAAGCAGAGGGGTGCCGG No data
938375890_938375902 24 Left 938375890 2:130806417-130806439 CCTTAATAAGGGGTAGGATGTGG No data
Right 938375902 2:130806464-130806486 CAGAGGAAGCAGAGGGGTGCCGG No data
938375889_938375902 25 Left 938375889 2:130806416-130806438 CCCTTAATAAGGGGTAGGATGTG No data
Right 938375902 2:130806464-130806486 CAGAGGAAGCAGAGGGGTGCCGG No data
938375888_938375902 26 Left 938375888 2:130806415-130806437 CCCCTTAATAAGGGGTAGGATGT No data
Right 938375902 2:130806464-130806486 CAGAGGAAGCAGAGGGGTGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938375902 Original CRISPR CAGAGGAAGCAGAGGGGTGC CGG Intergenic
No off target data available for this crispr