ID: 938380344

View in Genome Browser
Species Human (GRCh38)
Location 2:130832859-130832881
Sequence AGGTGCCCCTGCCCTGGCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938380338_938380344 11 Left 938380338 2:130832825-130832847 CCTGGCAGGGGAGCCTTCCTTAT No data
Right 938380344 2:130832859-130832881 AGGTGCCCCTGCCCTGGCTCTGG No data
938380340_938380344 -2 Left 938380340 2:130832838-130832860 CCTTCCTTATGTCAAGGCACAAG No data
Right 938380344 2:130832859-130832881 AGGTGCCCCTGCCCTGGCTCTGG No data
938380342_938380344 -6 Left 938380342 2:130832842-130832864 CCTTATGTCAAGGCACAAGGTGC No data
Right 938380344 2:130832859-130832881 AGGTGCCCCTGCCCTGGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938380344 Original CRISPR AGGTGCCCCTGCCCTGGCTC TGG Intergenic
No off target data available for this crispr