ID: 938382105

View in Genome Browser
Species Human (GRCh38)
Location 2:130842461-130842483
Sequence TAACACACTCTGTCCTCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938382105_938382107 1 Left 938382105 2:130842461-130842483 CCCTGTGAGGACAGAGTGTGTTA No data
Right 938382107 2:130842485-130842507 TACCTCACTTTAAGCTGTACAGG No data
938382105_938382110 28 Left 938382105 2:130842461-130842483 CCCTGTGAGGACAGAGTGTGTTA No data
Right 938382110 2:130842512-130842534 TTAGAAGTAGCAAGCGCACCCGG No data
938382105_938382108 2 Left 938382105 2:130842461-130842483 CCCTGTGAGGACAGAGTGTGTTA No data
Right 938382108 2:130842486-130842508 ACCTCACTTTAAGCTGTACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938382105 Original CRISPR TAACACACTCTGTCCTCACA GGG (reversed) Intronic
No off target data available for this crispr