ID: 938382107

View in Genome Browser
Species Human (GRCh38)
Location 2:130842485-130842507
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938382106_938382107 0 Left 938382106 2:130842462-130842484 CCTGTGAGGACAGAGTGTGTTAT No data
Right 938382107 2:130842485-130842507 TACCTCACTTTAAGCTGTACAGG No data
938382105_938382107 1 Left 938382105 2:130842461-130842483 CCCTGTGAGGACAGAGTGTGTTA No data
Right 938382107 2:130842485-130842507 TACCTCACTTTAAGCTGTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type