ID: 938382108

View in Genome Browser
Species Human (GRCh38)
Location 2:130842486-130842508
Sequence ACCTCACTTTAAGCTGTACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938382105_938382108 2 Left 938382105 2:130842461-130842483 CCCTGTGAGGACAGAGTGTGTTA No data
Right 938382108 2:130842486-130842508 ACCTCACTTTAAGCTGTACAGGG No data
938382106_938382108 1 Left 938382106 2:130842462-130842484 CCTGTGAGGACAGAGTGTGTTAT No data
Right 938382108 2:130842486-130842508 ACCTCACTTTAAGCTGTACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938382108 Original CRISPR ACCTCACTTTAAGCTGTACA GGG Intronic