ID: 938382110

View in Genome Browser
Species Human (GRCh38)
Location 2:130842512-130842534
Sequence TTAGAAGTAGCAAGCGCACC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938382106_938382110 27 Left 938382106 2:130842462-130842484 CCTGTGAGGACAGAGTGTGTTAT No data
Right 938382110 2:130842512-130842534 TTAGAAGTAGCAAGCGCACCCGG No data
938382109_938382110 2 Left 938382109 2:130842487-130842509 CCTCACTTTAAGCTGTACAGGGC No data
Right 938382110 2:130842512-130842534 TTAGAAGTAGCAAGCGCACCCGG No data
938382105_938382110 28 Left 938382105 2:130842461-130842483 CCCTGTGAGGACAGAGTGTGTTA No data
Right 938382110 2:130842512-130842534 TTAGAAGTAGCAAGCGCACCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938382110 Original CRISPR TTAGAAGTAGCAAGCGCACC CGG Intronic