ID: 938382268

View in Genome Browser
Species Human (GRCh38)
Location 2:130843372-130843394
Sequence TGCCCTCTTGAACCCTACAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938382262_938382268 8 Left 938382262 2:130843341-130843363 CCAAGGCTGGAGACCCTGAGCTG No data
Right 938382268 2:130843372-130843394 TGCCCTCTTGAACCCTACAGAGG No data
938382267_938382268 -6 Left 938382267 2:130843355-130843377 CCTGAGCTGAGGCGGGCTGCCCT No data
Right 938382268 2:130843372-130843394 TGCCCTCTTGAACCCTACAGAGG No data
938382261_938382268 9 Left 938382261 2:130843340-130843362 CCCAAGGCTGGAGACCCTGAGCT No data
Right 938382268 2:130843372-130843394 TGCCCTCTTGAACCCTACAGAGG No data
938382266_938382268 -5 Left 938382266 2:130843354-130843376 CCCTGAGCTGAGGCGGGCTGCCC No data
Right 938382268 2:130843372-130843394 TGCCCTCTTGAACCCTACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938382268 Original CRISPR TGCCCTCTTGAACCCTACAG AGG Intronic
No off target data available for this crispr