ID: 938382348

View in Genome Browser
Species Human (GRCh38)
Location 2:130843701-130843723
Sequence CCAATTATGTCCCAACAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938382348_938382352 6 Left 938382348 2:130843701-130843723 CCTGCTTGTTGGGACATAATTGG No data
Right 938382352 2:130843730-130843752 CAAAGGTTGTTCTCTCCCTCTGG No data
938382348_938382357 22 Left 938382348 2:130843701-130843723 CCTGCTTGTTGGGACATAATTGG No data
Right 938382357 2:130843746-130843768 CCTCTGGGCTGTCGGCTCTGAGG No data
938382348_938382358 23 Left 938382348 2:130843701-130843723 CCTGCTTGTTGGGACATAATTGG No data
Right 938382358 2:130843747-130843769 CTCTGGGCTGTCGGCTCTGAGGG No data
938382348_938382354 14 Left 938382348 2:130843701-130843723 CCTGCTTGTTGGGACATAATTGG No data
Right 938382354 2:130843738-130843760 GTTCTCTCCCTCTGGGCTGTCGG No data
938382348_938382353 7 Left 938382348 2:130843701-130843723 CCTGCTTGTTGGGACATAATTGG No data
Right 938382353 2:130843731-130843753 AAAGGTTGTTCTCTCCCTCTGGG No data
938382348_938382359 27 Left 938382348 2:130843701-130843723 CCTGCTTGTTGGGACATAATTGG No data
Right 938382359 2:130843751-130843773 GGGCTGTCGGCTCTGAGGGCAGG No data
938382348_938382360 28 Left 938382348 2:130843701-130843723 CCTGCTTGTTGGGACATAATTGG No data
Right 938382360 2:130843752-130843774 GGCTGTCGGCTCTGAGGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938382348 Original CRISPR CCAATTATGTCCCAACAAGC AGG (reversed) Intronic
No off target data available for this crispr