ID: 938382872

View in Genome Browser
Species Human (GRCh38)
Location 2:130846493-130846515
Sequence CCCCGCAGGCAGGTTCCTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938382872_938382890 25 Left 938382872 2:130846493-130846515 CCCTCAGGAACCTGCCTGCGGGG No data
Right 938382890 2:130846541-130846563 GCACATGGGGAGAGCGATATGGG No data
938382872_938382886 11 Left 938382872 2:130846493-130846515 CCCTCAGGAACCTGCCTGCGGGG No data
Right 938382886 2:130846527-130846549 TGCCGTGGGGAGGTGCACATGGG No data
938382872_938382891 29 Left 938382872 2:130846493-130846515 CCCTCAGGAACCTGCCTGCGGGG No data
Right 938382891 2:130846545-130846567 ATGGGGAGAGCGATATGGGACGG No data
938382872_938382879 -3 Left 938382872 2:130846493-130846515 CCCTCAGGAACCTGCCTGCGGGG No data
Right 938382879 2:130846513-130846535 GGGGCTGTGACCCCTGCCGTGGG No data
938382872_938382885 10 Left 938382872 2:130846493-130846515 CCCTCAGGAACCTGCCTGCGGGG No data
Right 938382885 2:130846526-130846548 CTGCCGTGGGGAGGTGCACATGG No data
938382872_938382880 -2 Left 938382872 2:130846493-130846515 CCCTCAGGAACCTGCCTGCGGGG No data
Right 938382880 2:130846514-130846536 GGGCTGTGACCCCTGCCGTGGGG No data
938382872_938382889 24 Left 938382872 2:130846493-130846515 CCCTCAGGAACCTGCCTGCGGGG No data
Right 938382889 2:130846540-130846562 TGCACATGGGGAGAGCGATATGG No data
938382872_938382887 12 Left 938382872 2:130846493-130846515 CCCTCAGGAACCTGCCTGCGGGG No data
Right 938382887 2:130846528-130846550 GCCGTGGGGAGGTGCACATGGGG No data
938382872_938382878 -4 Left 938382872 2:130846493-130846515 CCCTCAGGAACCTGCCTGCGGGG No data
Right 938382878 2:130846512-130846534 GGGGGCTGTGACCCCTGCCGTGG No data
938382872_938382881 1 Left 938382872 2:130846493-130846515 CCCTCAGGAACCTGCCTGCGGGG No data
Right 938382881 2:130846517-130846539 CTGTGACCCCTGCCGTGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938382872 Original CRISPR CCCCGCAGGCAGGTTCCTGA GGG (reversed) Intronic
No off target data available for this crispr