ID: 938383985

View in Genome Browser
Species Human (GRCh38)
Location 2:130851797-130851819
Sequence CCCGGAGAGACTGGCAGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938383985_938383992 28 Left 938383985 2:130851797-130851819 CCTGCTCTGCCAGTCTCTCCGGG No data
Right 938383992 2:130851848-130851870 GAGTGAATGTTTGTAGAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938383985 Original CRISPR CCCGGAGAGACTGGCAGAGC AGG (reversed) Intronic
No off target data available for this crispr