ID: 938386368

View in Genome Browser
Species Human (GRCh38)
Location 2:130870096-130870118
Sequence CTGCAGGGGTTGACAGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938386368_938386375 1 Left 938386368 2:130870096-130870118 CCCTCTGCTGTCAACCCCTGCAG No data
Right 938386375 2:130870120-130870142 GCCTCAGAGAAAGACGCTGCTGG No data
938386368_938386380 9 Left 938386368 2:130870096-130870118 CCCTCTGCTGTCAACCCCTGCAG No data
Right 938386380 2:130870128-130870150 GAAAGACGCTGCTGGAGGGTGGG No data
938386368_938386381 12 Left 938386368 2:130870096-130870118 CCCTCTGCTGTCAACCCCTGCAG No data
Right 938386381 2:130870131-130870153 AGACGCTGCTGGAGGGTGGGAGG No data
938386368_938386377 4 Left 938386368 2:130870096-130870118 CCCTCTGCTGTCAACCCCTGCAG No data
Right 938386377 2:130870123-130870145 TCAGAGAAAGACGCTGCTGGAGG No data
938386368_938386379 8 Left 938386368 2:130870096-130870118 CCCTCTGCTGTCAACCCCTGCAG No data
Right 938386379 2:130870127-130870149 AGAAAGACGCTGCTGGAGGGTGG No data
938386368_938386378 5 Left 938386368 2:130870096-130870118 CCCTCTGCTGTCAACCCCTGCAG No data
Right 938386378 2:130870124-130870146 CAGAGAAAGACGCTGCTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938386368 Original CRISPR CTGCAGGGGTTGACAGCAGA GGG (reversed) Intronic
No off target data available for this crispr