ID: 938386404

View in Genome Browser
Species Human (GRCh38)
Location 2:130870218-130870240
Sequence CAGGGTAGGCTGAAGGGGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938386393_938386404 -9 Left 938386393 2:130870204-130870226 CCTCCTCCCCAGCCCAGGGTAGG No data
Right 938386404 2:130870218-130870240 CAGGGTAGGCTGAAGGGGCAAGG No data
938386390_938386404 3 Left 938386390 2:130870192-130870214 CCTCTTGTGGCACCTCCTCCCCA No data
Right 938386404 2:130870218-130870240 CAGGGTAGGCTGAAGGGGCAAGG No data
938386389_938386404 4 Left 938386389 2:130870191-130870213 CCCTCTTGTGGCACCTCCTCCCC No data
Right 938386404 2:130870218-130870240 CAGGGTAGGCTGAAGGGGCAAGG No data
938386387_938386404 24 Left 938386387 2:130870171-130870193 CCATGGGTATTGTTGCTTTTCCC No data
Right 938386404 2:130870218-130870240 CAGGGTAGGCTGAAGGGGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938386404 Original CRISPR CAGGGTAGGCTGAAGGGGCA AGG Intronic
No off target data available for this crispr