ID: 938386717

View in Genome Browser
Species Human (GRCh38)
Location 2:130872050-130872072
Sequence ACCGCAGCGCGGTTCAGGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938386710_938386717 19 Left 938386710 2:130872008-130872030 CCAGCTGTGCATCTGCAAAATGG No data
Right 938386717 2:130872050-130872072 ACCGCAGCGCGGTTCAGGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938386717 Original CRISPR ACCGCAGCGCGGTTCAGGTC AGG Intronic
No off target data available for this crispr