ID: 938387012

View in Genome Browser
Species Human (GRCh38)
Location 2:130873809-130873831
Sequence CCAGGGAACTTAGGGGTACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938387012_938387025 27 Left 938387012 2:130873809-130873831 CCAGGTACCCCTAAGTTCCCTGG No data
Right 938387025 2:130873859-130873881 GCAGGAAGTGACAGCTGTTTGGG No data
938387012_938387019 -3 Left 938387012 2:130873809-130873831 CCAGGTACCCCTAAGTTCCCTGG No data
Right 938387019 2:130873829-130873851 TGGTCCATCTGATTTCATCCAGG No data
938387012_938387024 26 Left 938387012 2:130873809-130873831 CCAGGTACCCCTAAGTTCCCTGG No data
Right 938387024 2:130873858-130873880 TGCAGGAAGTGACAGCTGTTTGG No data
938387012_938387021 9 Left 938387012 2:130873809-130873831 CCAGGTACCCCTAAGTTCCCTGG No data
Right 938387021 2:130873841-130873863 TTTCATCCAGGCCGCTTTGCAGG No data
938387012_938387026 28 Left 938387012 2:130873809-130873831 CCAGGTACCCCTAAGTTCCCTGG No data
Right 938387026 2:130873860-130873882 CAGGAAGTGACAGCTGTTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938387012 Original CRISPR CCAGGGAACTTAGGGGTACC TGG (reversed) Intronic
No off target data available for this crispr