ID: 938387014

View in Genome Browser
Species Human (GRCh38)
Location 2:130873816-130873838
Sequence AGATGGACCAGGGAACTTAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938387014_938387019 -10 Left 938387014 2:130873816-130873838 CCCCTAAGTTCCCTGGTCCATCT No data
Right 938387019 2:130873829-130873851 TGGTCCATCTGATTTCATCCAGG No data
938387014_938387025 20 Left 938387014 2:130873816-130873838 CCCCTAAGTTCCCTGGTCCATCT No data
Right 938387025 2:130873859-130873881 GCAGGAAGTGACAGCTGTTTGGG No data
938387014_938387027 29 Left 938387014 2:130873816-130873838 CCCCTAAGTTCCCTGGTCCATCT No data
Right 938387027 2:130873868-130873890 GACAGCTGTTTGGGGTTCCTTGG No data
938387014_938387024 19 Left 938387014 2:130873816-130873838 CCCCTAAGTTCCCTGGTCCATCT No data
Right 938387024 2:130873858-130873880 TGCAGGAAGTGACAGCTGTTTGG No data
938387014_938387026 21 Left 938387014 2:130873816-130873838 CCCCTAAGTTCCCTGGTCCATCT No data
Right 938387026 2:130873860-130873882 CAGGAAGTGACAGCTGTTTGGGG No data
938387014_938387021 2 Left 938387014 2:130873816-130873838 CCCCTAAGTTCCCTGGTCCATCT No data
Right 938387021 2:130873841-130873863 TTTCATCCAGGCCGCTTTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938387014 Original CRISPR AGATGGACCAGGGAACTTAG GGG (reversed) Intronic
No off target data available for this crispr