ID: 938387017

View in Genome Browser
Species Human (GRCh38)
Location 2:130873826-130873848
Sequence GGATGAAATCAGATGGACCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938387017_938387025 10 Left 938387017 2:130873826-130873848 CCCTGGTCCATCTGATTTCATCC No data
Right 938387025 2:130873859-130873881 GCAGGAAGTGACAGCTGTTTGGG No data
938387017_938387021 -8 Left 938387017 2:130873826-130873848 CCCTGGTCCATCTGATTTCATCC No data
Right 938387021 2:130873841-130873863 TTTCATCCAGGCCGCTTTGCAGG No data
938387017_938387026 11 Left 938387017 2:130873826-130873848 CCCTGGTCCATCTGATTTCATCC No data
Right 938387026 2:130873860-130873882 CAGGAAGTGACAGCTGTTTGGGG No data
938387017_938387024 9 Left 938387017 2:130873826-130873848 CCCTGGTCCATCTGATTTCATCC No data
Right 938387024 2:130873858-130873880 TGCAGGAAGTGACAGCTGTTTGG No data
938387017_938387027 19 Left 938387017 2:130873826-130873848 CCCTGGTCCATCTGATTTCATCC No data
Right 938387027 2:130873868-130873890 GACAGCTGTTTGGGGTTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938387017 Original CRISPR GGATGAAATCAGATGGACCA GGG (reversed) Intronic
No off target data available for this crispr