ID: 938387019

View in Genome Browser
Species Human (GRCh38)
Location 2:130873829-130873851
Sequence TGGTCCATCTGATTTCATCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938387010_938387019 15 Left 938387010 2:130873791-130873813 CCATACTGTCTTGGATTTCCAGG No data
Right 938387019 2:130873829-130873851 TGGTCCATCTGATTTCATCCAGG No data
938387012_938387019 -3 Left 938387012 2:130873809-130873831 CCAGGTACCCCTAAGTTCCCTGG No data
Right 938387019 2:130873829-130873851 TGGTCCATCTGATTTCATCCAGG No data
938387014_938387019 -10 Left 938387014 2:130873816-130873838 CCCCTAAGTTCCCTGGTCCATCT No data
Right 938387019 2:130873829-130873851 TGGTCCATCTGATTTCATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938387019 Original CRISPR TGGTCCATCTGATTTCATCC AGG Intronic
No off target data available for this crispr