ID: 938387020

View in Genome Browser
Species Human (GRCh38)
Location 2:130873833-130873855
Sequence GCGGCCTGGATGAAATCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938387020_938387026 4 Left 938387020 2:130873833-130873855 CCATCTGATTTCATCCAGGCCGC No data
Right 938387026 2:130873860-130873882 CAGGAAGTGACAGCTGTTTGGGG No data
938387020_938387028 25 Left 938387020 2:130873833-130873855 CCATCTGATTTCATCCAGGCCGC No data
Right 938387028 2:130873881-130873903 GGTTCCTTGGTGCCCCCTGCCGG No data
938387020_938387027 12 Left 938387020 2:130873833-130873855 CCATCTGATTTCATCCAGGCCGC No data
Right 938387027 2:130873868-130873890 GACAGCTGTTTGGGGTTCCTTGG No data
938387020_938387024 2 Left 938387020 2:130873833-130873855 CCATCTGATTTCATCCAGGCCGC No data
Right 938387024 2:130873858-130873880 TGCAGGAAGTGACAGCTGTTTGG No data
938387020_938387025 3 Left 938387020 2:130873833-130873855 CCATCTGATTTCATCCAGGCCGC No data
Right 938387025 2:130873859-130873881 GCAGGAAGTGACAGCTGTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938387020 Original CRISPR GCGGCCTGGATGAAATCAGA TGG (reversed) Intronic
No off target data available for this crispr