ID: 938387024

View in Genome Browser
Species Human (GRCh38)
Location 2:130873858-130873880
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938387012_938387024 26 Left 938387012 2:130873809-130873831 CCAGGTACCCCTAAGTTCCCTGG No data
Right 938387024 2:130873858-130873880 TGCAGGAAGTGACAGCTGTTTGG No data
938387018_938387024 8 Left 938387018 2:130873827-130873849 CCTGGTCCATCTGATTTCATCCA No data
Right 938387024 2:130873858-130873880 TGCAGGAAGTGACAGCTGTTTGG No data
938387014_938387024 19 Left 938387014 2:130873816-130873838 CCCCTAAGTTCCCTGGTCCATCT No data
Right 938387024 2:130873858-130873880 TGCAGGAAGTGACAGCTGTTTGG No data
938387015_938387024 18 Left 938387015 2:130873817-130873839 CCCTAAGTTCCCTGGTCCATCTG No data
Right 938387024 2:130873858-130873880 TGCAGGAAGTGACAGCTGTTTGG No data
938387017_938387024 9 Left 938387017 2:130873826-130873848 CCCTGGTCCATCTGATTTCATCC No data
Right 938387024 2:130873858-130873880 TGCAGGAAGTGACAGCTGTTTGG No data
938387016_938387024 17 Left 938387016 2:130873818-130873840 CCTAAGTTCCCTGGTCCATCTGA No data
Right 938387024 2:130873858-130873880 TGCAGGAAGTGACAGCTGTTTGG No data
938387020_938387024 2 Left 938387020 2:130873833-130873855 CCATCTGATTTCATCCAGGCCGC No data
Right 938387024 2:130873858-130873880 TGCAGGAAGTGACAGCTGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr