ID: 938387027

View in Genome Browser
Species Human (GRCh38)
Location 2:130873868-130873890
Sequence GACAGCTGTTTGGGGTTCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938387020_938387027 12 Left 938387020 2:130873833-130873855 CCATCTGATTTCATCCAGGCCGC No data
Right 938387027 2:130873868-130873890 GACAGCTGTTTGGGGTTCCTTGG No data
938387014_938387027 29 Left 938387014 2:130873816-130873838 CCCCTAAGTTCCCTGGTCCATCT No data
Right 938387027 2:130873868-130873890 GACAGCTGTTTGGGGTTCCTTGG No data
938387017_938387027 19 Left 938387017 2:130873826-130873848 CCCTGGTCCATCTGATTTCATCC No data
Right 938387027 2:130873868-130873890 GACAGCTGTTTGGGGTTCCTTGG No data
938387022_938387027 -2 Left 938387022 2:130873847-130873869 CCAGGCCGCTTTGCAGGAAGTGA No data
Right 938387027 2:130873868-130873890 GACAGCTGTTTGGGGTTCCTTGG No data
938387015_938387027 28 Left 938387015 2:130873817-130873839 CCCTAAGTTCCCTGGTCCATCTG No data
Right 938387027 2:130873868-130873890 GACAGCTGTTTGGGGTTCCTTGG No data
938387018_938387027 18 Left 938387018 2:130873827-130873849 CCTGGTCCATCTGATTTCATCCA No data
Right 938387027 2:130873868-130873890 GACAGCTGTTTGGGGTTCCTTGG No data
938387016_938387027 27 Left 938387016 2:130873818-130873840 CCTAAGTTCCCTGGTCCATCTGA No data
Right 938387027 2:130873868-130873890 GACAGCTGTTTGGGGTTCCTTGG No data
938387023_938387027 -7 Left 938387023 2:130873852-130873874 CCGCTTTGCAGGAAGTGACAGCT No data
Right 938387027 2:130873868-130873890 GACAGCTGTTTGGGGTTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938387027 Original CRISPR GACAGCTGTTTGGGGTTCCT TGG Intronic
No off target data available for this crispr