ID: 938388787

View in Genome Browser
Species Human (GRCh38)
Location 2:130887851-130887873
Sequence CCACGCCGGCAGGGTTTCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938388772_938388787 26 Left 938388772 2:130887802-130887824 CCAGGACGGCGTCCTTTGCCTCC No data
Right 938388787 2:130887851-130887873 CCACGCCGGCAGGGTTTCATGGG No data
938388777_938388787 8 Left 938388777 2:130887820-130887842 CCTCCACTGTGCTGGGAAGGAGG No data
Right 938388787 2:130887851-130887873 CCACGCCGGCAGGGTTTCATGGG No data
938388779_938388787 5 Left 938388779 2:130887823-130887845 CCACTGTGCTGGGAAGGAGGATG No data
Right 938388787 2:130887851-130887873 CCACGCCGGCAGGGTTTCATGGG No data
938388775_938388787 14 Left 938388775 2:130887814-130887836 CCTTTGCCTCCACTGTGCTGGGA No data
Right 938388787 2:130887851-130887873 CCACGCCGGCAGGGTTTCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938388787 Original CRISPR CCACGCCGGCAGGGTTTCAT GGG Intronic
No off target data available for this crispr