ID: 938389656

View in Genome Browser
Species Human (GRCh38)
Location 2:130894766-130894788
Sequence ACCTCCCGCCACAGGAGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938389656_938389663 8 Left 938389656 2:130894766-130894788 CCTCTCCTCCTGTGGCGGGAGGT No data
Right 938389663 2:130894797-130894819 CCCCATCCTCTAGGCAGTCTAGG No data
938389656_938389668 18 Left 938389656 2:130894766-130894788 CCTCTCCTCCTGTGGCGGGAGGT No data
Right 938389668 2:130894807-130894829 TAGGCAGTCTAGGCATGGCCAGG No data
938389656_938389661 -1 Left 938389656 2:130894766-130894788 CCTCTCCTCCTGTGGCGGGAGGT No data
Right 938389661 2:130894788-130894810 TTGGGCAGTCCCCATCCTCTAGG No data
938389656_938389666 13 Left 938389656 2:130894766-130894788 CCTCTCCTCCTGTGGCGGGAGGT No data
Right 938389666 2:130894802-130894824 TCCTCTAGGCAGTCTAGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938389656 Original CRISPR ACCTCCCGCCACAGGAGGAG AGG (reversed) Intronic