ID: 938392385

View in Genome Browser
Species Human (GRCh38)
Location 2:130916143-130916165
Sequence TCCCCACGCAGTCTCTCTCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 229}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938392385_938392389 -2 Left 938392385 2:130916143-130916165 CCGGGAGAGAGACTGCGTGGGGA 0: 1
1: 0
2: 0
3: 13
4: 229
Right 938392389 2:130916164-130916186 GAGAGCCGGAGCTCCGGGTCAGG 0: 1
1: 1
2: 0
3: 9
4: 128
938392385_938392397 18 Left 938392385 2:130916143-130916165 CCGGGAGAGAGACTGCGTGGGGA 0: 1
1: 0
2: 0
3: 13
4: 229
Right 938392397 2:130916184-130916206 AGGGGAGCGTGGCCCGGAGGAGG 0: 1
1: 0
2: 4
3: 35
4: 363
938392385_938392395 12 Left 938392385 2:130916143-130916165 CCGGGAGAGAGACTGCGTGGGGA 0: 1
1: 0
2: 0
3: 13
4: 229
Right 938392395 2:130916178-130916200 CGGGTCAGGGGAGCGTGGCCCGG 0: 1
1: 0
2: 3
3: 28
4: 274
938392385_938392393 7 Left 938392385 2:130916143-130916165 CCGGGAGAGAGACTGCGTGGGGA 0: 1
1: 0
2: 0
3: 13
4: 229
Right 938392393 2:130916173-130916195 AGCTCCGGGTCAGGGGAGCGTGG 0: 1
1: 0
2: 0
3: 14
4: 184
938392385_938392387 -8 Left 938392385 2:130916143-130916165 CCGGGAGAGAGACTGCGTGGGGA 0: 1
1: 0
2: 0
3: 13
4: 229
Right 938392387 2:130916158-130916180 CGTGGGGAGAGCCGGAGCTCCGG 0: 1
1: 0
2: 0
3: 23
4: 255
938392385_938392388 -7 Left 938392385 2:130916143-130916165 CCGGGAGAGAGACTGCGTGGGGA 0: 1
1: 0
2: 0
3: 13
4: 229
Right 938392388 2:130916159-130916181 GTGGGGAGAGCCGGAGCTCCGGG 0: 1
1: 0
2: 2
3: 25
4: 356
938392385_938392391 0 Left 938392385 2:130916143-130916165 CCGGGAGAGAGACTGCGTGGGGA 0: 1
1: 0
2: 0
3: 13
4: 229
Right 938392391 2:130916166-130916188 GAGCCGGAGCTCCGGGTCAGGGG 0: 1
1: 0
2: 0
3: 6
4: 161
938392385_938392396 15 Left 938392385 2:130916143-130916165 CCGGGAGAGAGACTGCGTGGGGA 0: 1
1: 0
2: 0
3: 13
4: 229
Right 938392396 2:130916181-130916203 GTCAGGGGAGCGTGGCCCGGAGG 0: 1
1: 0
2: 2
3: 17
4: 193
938392385_938392398 28 Left 938392385 2:130916143-130916165 CCGGGAGAGAGACTGCGTGGGGA 0: 1
1: 0
2: 0
3: 13
4: 229
Right 938392398 2:130916194-130916216 GGCCCGGAGGAGGCCCCCGAAGG 0: 1
1: 2
2: 3
3: 14
4: 215
938392385_938392390 -1 Left 938392385 2:130916143-130916165 CCGGGAGAGAGACTGCGTGGGGA 0: 1
1: 0
2: 0
3: 13
4: 229
Right 938392390 2:130916165-130916187 AGAGCCGGAGCTCCGGGTCAGGG 0: 1
1: 0
2: 0
3: 8
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938392385 Original CRISPR TCCCCACGCAGTCTCTCTCC CGG (reversed) Intronic
900461634 1:2804735-2804757 TCCCCCCGCAGGCGCTCACCTGG + Intergenic
901524118 1:9808661-9808683 TCTCCACTCAGTCTGTCCCCAGG - Intronic
901626725 1:10629150-10629172 TCACCAACCTGTCTCTCTCCTGG + Intronic
903651626 1:24926025-24926047 TCCCTTCCCACTCTCTCTCCTGG - Intronic
904266169 1:29319631-29319653 TCCCCCAGCGATCTCTCTCCAGG - Intronic
904320416 1:29694497-29694519 TCCCCAGTCAGCCTCTCACCAGG - Intergenic
904789935 1:33011952-33011974 TTCAAACCCAGTCTCTCTCCAGG - Intronic
906201635 1:43964165-43964187 CCCCCACGCTGTCTCCCTGCAGG + Intronic
907439275 1:54468863-54468885 TCCCCACACAGTGTCCCTACTGG + Intergenic
909241666 1:73221609-73221631 CCCCCACACAGTGTCTCTACTGG - Intergenic
910132002 1:83918976-83918998 TCCCTACACAGTCTCTCAGCAGG - Intronic
912512678 1:110199480-110199502 TCCCCAGGAAGCCTCACTCCTGG + Exonic
914345384 1:146794454-146794476 TCTCCAGGCGCTCTCTCTCCCGG - Intergenic
914428379 1:147599539-147599561 TCCCCACGCGCTCACTCTCCCGG - Intronic
915934454 1:160082595-160082617 TACCCAGGCAGTTTCTCCCCAGG + Intronic
916016703 1:160756165-160756187 TCCCCACCCATTCTCACTCGAGG - Intergenic
916184664 1:162119168-162119190 ACCCCAAGCAGCCTCTCTTCCGG - Intronic
916424816 1:164670325-164670347 TCCCCACTCAATCCCTTTCCAGG + Intronic
916443380 1:164849241-164849263 TGCACAGGCAGTTTCTCTCCGGG + Exonic
916829663 1:168477516-168477538 TGCCAACACTGTCTCTCTCCTGG - Intergenic
917082664 1:171272386-171272408 TCCCCACACAGAGTCTCTACTGG + Intronic
917624478 1:176831599-176831621 TCCCCATGCAGTCTCTCCTCTGG - Intronic
919938051 1:202268029-202268051 ACCCCTCCCAGCCTCTCTCCTGG - Intronic
920852106 1:209634956-209634978 TCCTCTCTCTGTCTCTCTCCTGG + Intronic
921826281 1:219675389-219675411 ACCCAACGAAGTCTCTCTTCTGG - Intergenic
921965086 1:221079615-221079637 GCCCCACCCAGCCTCTCTCAAGG - Intergenic
923073033 1:230583205-230583227 TCCCCAGGCAGTGTCTTTACTGG - Intergenic
1065347723 10:24764845-24764867 GCCCCACGCAGACTCCCTACTGG - Intergenic
1071713834 10:88075252-88075274 TCCCCAGCCAGTCTGGCTCCAGG - Intergenic
1073488013 10:103833955-103833977 TCCCCAGGGACTCTCTTTCCGGG - Intronic
1073604732 10:104882755-104882777 TCCCCACCCAGTGCCACTCCTGG + Intronic
1075015704 10:118908707-118908729 TGCCTGCGCAGTCCCTCTCCTGG - Intergenic
1075090936 10:119443943-119443965 GCCCCACCCAGGCTTTCTCCTGG - Intronic
1075638989 10:124050760-124050782 TCCCCACAGCGTCTCTCTACGGG - Intronic
1075649031 10:124115544-124115566 TGCCCAGGCAGTCTGACTCCAGG + Intergenic
1076567207 10:131406965-131406987 TGCCCATCCAGGCTCTCTCCAGG - Intergenic
1076981645 11:207953-207975 CCGCCTCCCAGTCTCTCTCCCGG - Intronic
1077199376 11:1297795-1297817 CCCCCAGGCAGCCTCTCTCGAGG + Intronic
1077330568 11:1982253-1982275 CACCCCCGCAGTCCCTCTCCTGG - Intronic
1077341658 11:2028937-2028959 TCCCCACTCGCTCGCTCTCCAGG - Intergenic
1081866837 11:46364914-46364936 TCCCCCACCAGTCTCTCCCCAGG + Intronic
1081914090 11:46719787-46719809 CCTCCACGCACTCTCGCTCCAGG - Exonic
1081937717 11:46916929-46916951 TCCCCTCCCCGGCTCTCTCCTGG - Intronic
1084066026 11:66704915-66704937 TCTCCACGCAGGCTCTAGCCAGG - Exonic
1084857857 11:72000382-72000404 TGCCCACGTCGTCACTCTCCTGG + Exonic
1085014023 11:73160535-73160557 GCCCCATGCTCTCTCTCTCCTGG - Intergenic
1085044379 11:73344599-73344621 TCCCCACGCCGTCTCACTGAGGG + Intronic
1088024460 11:105161060-105161082 TCCTCACTCATTTTCTCTCCCGG - Intergenic
1088257588 11:107915796-107915818 TCCCAAAGCAGTGCCTCTCCAGG - Intronic
1089924066 11:122238857-122238879 TGCCCAGGCAGCCTCTCTGCTGG + Intergenic
1091079827 11:132655809-132655831 CCCCCACGCAACCTCTCTCTAGG + Intronic
1202813546 11_KI270721v1_random:37432-37454 CACCCCCGCAGTCCCTCTCCTGG - Intergenic
1202824644 11_KI270721v1_random:84126-84148 TCCCCACTCGCTCGCTCTCCAGG - Intergenic
1092162414 12:6323188-6323210 TCCCCTGGTAGTCTCACTCCAGG + Intronic
1092219032 12:6700507-6700529 TCCCGACGCGGTCCCTCGCCCGG - Intronic
1094063184 12:26336222-26336244 TCCCCACTCATTCTCAGTCCTGG + Intergenic
1094178113 12:27562982-27563004 TCCCCACGCTGCCTGTCTTCTGG + Intronic
1095960801 12:47833238-47833260 TCCCCTCCCAGTCCCTCCCCAGG + Intergenic
1095961118 12:47834918-47834940 TCCCCTCCCTGTCCCTCTCCGGG + Intergenic
1096186923 12:49587511-49587533 TCCCCAATAAATCTCTCTCCAGG - Exonic
1096967082 12:55637158-55637180 TCCCCAGGCCATCTCTTTCCAGG + Exonic
1097980149 12:65729549-65729571 TCCCCACCCAGTCTCAGTTCAGG - Intergenic
1098521669 12:71440315-71440337 TCCCCTCTTAGTCTCTCTCCCGG - Intronic
1102100452 12:110274394-110274416 CTCTCAGGCAGTCTCTCTCCAGG - Intergenic
1103921184 12:124399969-124399991 TCCCCACCCAGCCTCTACCCTGG - Intronic
1104188564 12:126456103-126456125 ACCCCACTCAGACTCTGTCCAGG + Intergenic
1104342835 12:127967313-127967335 TCCCCACACAGATTCTCTACTGG - Intergenic
1105016600 12:132789486-132789508 GCACCACGCAGTCTCTCAACAGG - Intronic
1106003546 13:25747628-25747650 TCCCCACGCATTGTATCCCCAGG - Intronic
1106561646 13:30851811-30851833 TCCCCACACAGTCTCTGCTCAGG - Intergenic
1108156206 13:47587624-47587646 TCCCCACGTCAGCTCTCTCCAGG - Intergenic
1108508608 13:51135252-51135274 TCTCCACCTGGTCTCTCTCCAGG - Intergenic
1109267347 13:60216763-60216785 TCCTAACTCTGTCTCTCTCCTGG - Intergenic
1109721103 13:66277445-66277467 TCCCCACACAGACTCCCTACTGG + Intergenic
1110460510 13:75739841-75739863 TCCCCACTTATTCTCTCTTCAGG + Intronic
1111105709 13:83642769-83642791 TCCCCACACAGAGTCTCTACTGG - Intergenic
1113603487 13:111588051-111588073 TCCTCACACAGTCACTCCCCAGG + Intergenic
1113914740 13:113863628-113863650 CCTCCACGCACTCCCTCTCCAGG + Exonic
1114575357 14:23707751-23707773 TCCCCACCCACCCCCTCTCCTGG - Intergenic
1115392175 14:32866164-32866186 TCCCCACCCACCCTCTCTGCTGG - Intergenic
1116164195 14:41312069-41312091 TCCCCACACAGAGTCTCTACTGG + Intergenic
1118903700 14:70007661-70007683 TCCCCAGCCTTTCTCTCTCCTGG + Intronic
1119919804 14:78436069-78436091 TCACCAAGCACTCTCACTCCTGG - Intronic
1121119822 14:91369675-91369697 TCTCCACCCAGTCCCTCTTCGGG + Intronic
1122031615 14:98916353-98916375 TCCCCCCGCTGCCTCTCTCATGG + Intergenic
1123054222 14:105561629-105561651 TGGCCACGCTCTCTCTCTCCTGG - Intergenic
1123078806 14:105682048-105682070 TGGCCACGCTCTCTCTCTCCTGG - Intergenic
1123800024 15:23809753-23809775 TTCCCACCCTGTCTCTCTCTTGG + Intergenic
1125533431 15:40428721-40428743 ACCCCCCACAGCCTCTCTCCAGG - Intronic
1127775942 15:62264408-62264430 GCCCCACCCAGCCTGTCTCCAGG + Intergenic
1128223036 15:65982171-65982193 TCCCCACCCAGGCACCCTCCAGG + Intronic
1128279898 15:66386489-66386511 TCCCCACGCTGCCTCTCCTCTGG + Intronic
1128282929 15:66411833-66411855 TTCCCACCCATTCTCTGTCCAGG + Intronic
1128510961 15:68313735-68313757 TCCCCATGCCTTCCCTCTCCTGG + Intronic
1129006183 15:72375665-72375687 TCCCCAGGCAGGCACTCTCAGGG + Intronic
1129052736 15:72796587-72796609 ACCCCACGCACCCTCTCTTCTGG - Intergenic
1129199810 15:73992100-73992122 TCCCCACGCCGCCCCGCTCCGGG + Exonic
1129262177 15:74374536-74374558 TCCCCACGCGTTCACGCTCCAGG - Intergenic
1129771962 15:78208307-78208329 CCCCCACCCAGCCTCCCTCCAGG + Intronic
1129779991 15:78264102-78264124 TCCCCACCCGGCCTCTCCCCGGG - Exonic
1131752608 15:95526006-95526028 TCCCCACACAGTGTCCCTACTGG - Intergenic
1133043059 16:3070840-3070862 CCCCCACACAGACTCTCTACTGG - Intronic
1134057905 16:11181709-11181731 TCCCAGCCCAGTCCCTCTCCCGG + Exonic
1134659931 16:15976490-15976512 AACCCAGGCAGTCTGTCTCCAGG + Intronic
1135460862 16:22641633-22641655 GCCTCATGCAGTCTCTCACCAGG + Intergenic
1135855195 16:26003499-26003521 TTCTCAGGCAGTCTCTCCCCTGG + Intronic
1136038419 16:27558966-27558988 TCCCCACAGACTCACTCTCCAGG - Intronic
1139078678 16:63486805-63486827 CCACCACGCAGTGTTTCTCCTGG + Intergenic
1139467499 16:67161795-67161817 TCCTCTGGCAGTCCCTCTCCAGG - Exonic
1139988605 16:70920824-70920846 TCTCCAGGCGCTCTCTCTCCCGG + Exonic
1140065660 16:71609173-71609195 TCCTTAAGCACTCTCTCTCCTGG + Intergenic
1141406874 16:83802337-83802359 CCCCTAGGCAGTCTGTCTCCAGG + Intergenic
1142489706 17:270285-270307 TCTCCATGCTGTTTCTCTCCTGG - Intronic
1142713791 17:1737267-1737289 TCCCTCCGCAGTTTCTCTCCAGG - Intronic
1143285355 17:5785110-5785132 TCCTCACGCAGACTGTCTTCTGG + Intronic
1143523876 17:7461719-7461741 TCCCCTCTCAGTCTTCCTCCAGG - Exonic
1145189655 17:20827856-20827878 TCTCCATGCAGCCTCTCTACAGG - Intergenic
1150077246 17:62203079-62203101 TCTCCATGCAGCCTCTCTACAGG + Intergenic
1151106161 17:71619216-71619238 TCCCCACACAGACTCCCTACTGG + Intergenic
1155041759 18:22070749-22070771 TCCCAAGGCCGTCTCTGTCCTGG - Intergenic
1157599597 18:48885833-48885855 TCCTCATGCAGTCTCACTGCTGG - Intergenic
1159714242 18:71801672-71801694 TATCCACTCTGTCTCTCTCCTGG - Intergenic
1160096473 18:75878041-75878063 TCCCCACACAGACTCCCTACTGG + Intergenic
1160896168 19:1402884-1402906 TGCCCAGACAGCCTCTCTCCTGG + Intergenic
1162904108 19:13813246-13813268 GCCCCACTCCCTCTCTCTCCTGG - Intronic
1164849778 19:31471968-31471990 TCCCCAGGGAGTCTCTCTGTGGG - Intergenic
1164872747 19:31659825-31659847 TCCCCACCCATTCCTTCTCCTGG + Intergenic
1165950971 19:39473741-39473763 CACCCAGGCAGTCTTTCTCCAGG - Intronic
1167159217 19:47756421-47756443 GCCCCATGCAGTCTCCCCCCAGG - Intronic
1167622203 19:50566624-50566646 GGCCCAGCCAGTCTCTCTCCAGG - Intronic
1167709125 19:51099229-51099251 TCTCCTCCCAGTCTCTCTCTGGG - Intronic
1167781323 19:51601099-51601121 TCCCCTCCCAGTCTCTCTCTGGG + Intergenic
925001185 2:404001-404023 TCCCCACACAGAGTCTCTACTGG - Intergenic
925608368 2:5682535-5682557 TCCCCACCAGGCCTCTCTCCTGG + Intergenic
926133582 2:10320661-10320683 TCCCCAGGGATTCTCTCTCCAGG - Intronic
927501812 2:23588237-23588259 TACCAACTCAGCCTCTCTCCTGG - Intronic
928680112 2:33692915-33692937 TCCCCACACAGAGTCTCTACTGG - Intergenic
928744559 2:34396336-34396358 TCCCCTCGCTGGTTCTCTCCAGG - Intergenic
930018928 2:46989255-46989277 TCCCCACGCAGGCTGTTTCTGGG + Intronic
930465812 2:51748456-51748478 TCAACCCGCAGTCTCACTCCTGG - Intergenic
930534250 2:52628022-52628044 TACCCACCCAGTCTCTCTCATGG + Intergenic
933768966 2:85730788-85730810 TTCCCAGGCAGTCTCCCTCTGGG + Intergenic
935278466 2:101496513-101496535 GGCCCAAGCAGTTTCTCTCCAGG + Intergenic
936389258 2:112056340-112056362 TACACACACACTCTCTCTCCCGG - Intronic
938392385 2:130916143-130916165 TCCCCACGCAGTCTCTCTCCCGG - Intronic
939656809 2:144836250-144836272 TCCCCATGGAATCTCTCTCTGGG - Intergenic
939957669 2:148540208-148540230 TCCCAAGTCAGTGTCTCTCCTGG - Intergenic
939977619 2:148737397-148737419 TCCCCACACAGTCTTATTCCTGG + Intronic
943871671 2:193008139-193008161 TCCCCACACAGTGTCCCTACTGG - Intergenic
944377090 2:199058096-199058118 TCTCCACACAGGCTCACTCCTGG - Intergenic
947593571 2:231397792-231397814 TTCCAACGCAGTCTCACCCCTGG + Exonic
1169150257 20:3283879-3283901 TCCCCAGGCACTCTCTCTAAGGG - Intronic
1174448253 20:50604641-50604663 TCACCAGGTAGTATCTCTCCCGG + Exonic
1175383972 20:58582487-58582509 TTCTCAGGCAGTCTCTCCCCAGG + Intergenic
1175789775 20:61734004-61734026 TCCCAGCGCAGGCTGTCTCCTGG + Intronic
1176020430 20:62959851-62959873 TCCCCTCGCAGAGTCCCTCCAGG + Intronic
1176131784 20:63499351-63499373 TCCCCGCGCCGTCTCCGTCCCGG - Intergenic
1177176089 21:17702151-17702173 TTCCCAGGCAGTCACCCTCCAGG + Intergenic
1179026883 21:37686430-37686452 CCTCCACGCATTCACTCTCCCGG + Intronic
1179444005 21:41419028-41419050 CCCCCTCAAAGTCTCTCTCCTGG + Intergenic
1180023560 21:45145330-45145352 ACCCCACTCAGGCTCTGTCCTGG - Intronic
1180108668 21:45637407-45637429 GGCCCACACAGGCTCTCTCCTGG - Intergenic
1180332767 22:11547668-11547690 TCCCCAGGCAGTCTCCCCACTGG + Intergenic
1180595229 22:16968584-16968606 TACCCACACAGTGTCCCTCCTGG + Intronic
1181162321 22:20966074-20966096 GCCCCACCCAGTCTCCTTCCTGG + Intronic
1181167021 22:20989349-20989371 TCCTCACTCAGTGTCCCTCCTGG - Intronic
1181331934 22:22099378-22099400 GCCTCACCCAGTCTCTCCCCGGG + Intergenic
1181336970 22:22143551-22143573 CCCCAACTCAGTCTCTCTTCAGG + Intergenic
1182422301 22:30254435-30254457 TCCCCACAGAGTCACTCCCCAGG + Intergenic
1184777469 22:46630640-46630662 ACCCCAAGCAGCCTCACTCCTGG + Intronic
1185041937 22:48508550-48508572 TCCCCACTCAGGCTGTCTCCAGG - Intronic
950017763 3:9766202-9766224 TTCCCAAGCAGGCTCTCCCCAGG - Exonic
950455141 3:13088432-13088454 TCCCCACTCCTGCTCTCTCCAGG + Intergenic
953021062 3:39113540-39113562 TCTCCATGGAGTCTCCCTCCAGG - Intronic
955748839 3:62167582-62167604 TACCCAGGCAGTCTGGCTCCGGG + Intronic
956237793 3:67094257-67094279 TTCACACTCAGTCTCTCTCTTGG - Intergenic
958684743 3:97378422-97378444 CCCCCACGCAGAGTCCCTCCCGG + Intronic
960046855 3:113206973-113206995 TCCTCTCCCAGTTTCTCTCCTGG - Intergenic
960990061 3:123304402-123304424 TCCCCACGTAGTCCCGCTCCTGG - Intronic
962375595 3:134856256-134856278 TCCCCATGAAGTCCCTTTCCAGG - Intronic
963218089 3:142773705-142773727 TCCCCACCCACCCTCTTTCCTGG + Intronic
967125353 3:186418586-186418608 TTCCCAAGCAGTCACTCTCAAGG + Intergenic
967387875 3:188928463-188928485 TCCTCACACAGACCCTCTCCTGG + Intergenic
969223003 4:5773590-5773612 CCGCCTCCCAGTCTCTCTCCCGG - Intronic
972322277 4:37982986-37983008 CCCCCCAGCAGTCTCGCTCCAGG - Intronic
973290316 4:48464377-48464399 CCCCATCGCAGCCTCTCTCCAGG + Intergenic
974780354 4:66545442-66545464 TGCCCACGGAGTCTCGCTCATGG + Intergenic
977654286 4:99503930-99503952 TCCCCAAGCTGTCTCTGTCAAGG - Intergenic
979061411 4:116066711-116066733 TCCCCCTTCACTCTCTCTCCTGG - Intergenic
981324665 4:143432097-143432119 TCCCCACCATGTCTCTCTCCCGG - Intronic
986756729 5:10843815-10843837 TCCCCACGCAGAGTCTCTACTGG - Intergenic
988790072 5:34599617-34599639 TCCCCACCCTGTCTGTCTCTGGG - Intergenic
991322951 5:65396452-65396474 TGGCCACCCAGTTTCTCTCCTGG + Intronic
991639459 5:68738625-68738647 TCCCCACTGGGTCCCTCTCCGGG + Intergenic
992001847 5:72443905-72443927 TGCCGGCACAGTCTCTCTCCTGG + Exonic
992377472 5:76202435-76202457 TACCCAGGCAGTCTGGCTCCAGG + Intronic
992433523 5:76732842-76732864 ATCCCATGCAGTCCCTCTCCTGG + Exonic
998568826 5:143239201-143239223 TCCACACTCCTTCTCTCTCCTGG - Intergenic
1001812259 5:174637907-174637929 TCCCCACTCATTCTGCCTCCTGG + Intergenic
1002919971 6:1561098-1561120 TCCCCAGAAGGTCTCTCTCCTGG - Intergenic
1003014727 6:2459169-2459191 ATCTCAAGCAGTCTCTCTCCTGG + Intergenic
1003275572 6:4647782-4647804 TCCCCACCCCCTCTCGCTCCCGG + Intergenic
1003499787 6:6694846-6694868 TCCCCACTCCGTCTCCCTTCTGG - Intergenic
1006296872 6:33173690-33173712 TCCACACTCACCCTCTCTCCAGG + Exonic
1006317381 6:33298651-33298673 ACCCCACCCCGTCTCTCCCCAGG - Exonic
1006594424 6:35182432-35182454 CCCCCGCGCGGTCTGTCTCCCGG + Intergenic
1007140564 6:39568973-39568995 TCTCCACTCTCTCTCTCTCCAGG + Intronic
1017914002 6:158818505-158818527 TCCCCCTGCCCTCTCTCTCCCGG - Intronic
1018400118 6:163413937-163413959 GCCCCACGCAGGCGCGCTCCGGG + Intergenic
1019056045 6:169224311-169224333 TCCCCATGCAGCCTTTCCCCAGG - Intronic
1019198601 6:170296499-170296521 GCCCCACGCAGCCTCGCGCCCGG + Intronic
1019343017 7:517391-517413 TACCTACGGAGTCTATCTCCAGG + Exonic
1020111874 7:5452081-5452103 TCTCCACACAGCCTCCCTCCAGG - Intronic
1023598559 7:41858197-41858219 TCACCACACAGGCTCTCTCTGGG - Intergenic
1024182556 7:46910537-46910559 TCCTCAGCCAGTCTTTCTCCAGG - Intergenic
1024980299 7:55152646-55152668 TTACCAGGCAGTCGCTCTCCCGG - Exonic
1029327292 7:99821115-99821137 TCCTTACCCAGTCTGTCTCCTGG + Intergenic
1032580800 7:133101589-133101611 GCACCAAGCAGTCTCCCTCCCGG + Intergenic
1034474797 7:151276073-151276095 TCCCCTCCCACTCTGTCTCCCGG - Intronic
1037481729 8:19312442-19312464 CTCACACCCAGTCTCTCTCCAGG - Intergenic
1037589314 8:20300051-20300073 CCCCCACCCACTCTATCTCCAGG - Intronic
1039741807 8:40389764-40389786 TCCCCCCTCAGTTTCTCTCTTGG + Intergenic
1041449858 8:57994827-57994849 CCGCCCAGCAGTCTCTCTCCCGG - Intronic
1041986620 8:63930076-63930098 TCCCCATGCTCTCTCTCTCAAGG + Intergenic
1042057964 8:64786721-64786743 TCCCCACACAGAGTCACTCCTGG - Intronic
1043741802 8:83823598-83823620 TCCTCCCACAGTTTCTCTCCAGG + Intergenic
1045684948 8:104702338-104702360 TCCCCCTTCACTCTCTCTCCTGG + Intronic
1048268778 8:133011325-133011347 TCCCAACTGAGTCTCTCTCTAGG - Intronic
1048658281 8:136567911-136567933 TCCCCATTCACTCTTTCTCCTGG - Intergenic
1049694140 8:143975473-143975495 TCCCCACCCAGCCTCTCGCCTGG + Intronic
1051904029 9:22074710-22074732 TCCCCACCCACTACCTCTCCTGG + Intergenic
1057304435 9:93904139-93904161 TCCACACCCAGCCCCTCTCCTGG + Intergenic
1057904217 9:98971855-98971877 ACCCCACGCTCTCTCTCTCTGGG + Intronic
1058347901 9:103986296-103986318 TCCCCTCCCACTCTCTCTCTTGG - Intergenic
1061064608 9:128269578-128269600 GCCCCACCCAGCCTCTCTCCAGG + Intronic
1062139310 9:134947214-134947236 TCCTCACCCACTTTCTCTCCTGG + Intergenic
1062622410 9:137428823-137428845 GCCCCACCCAGGCCCTCTCCCGG - Intronic
1193981477 X:88186493-88186515 TCCCCAAGCAGCCTCTGTCAAGG + Intergenic
1194833351 X:98652573-98652595 TCACCAAGCTGTCTTTCTCCAGG + Intergenic
1196529102 X:116762242-116762264 TCCACTCTCATTCTCTCTCCAGG - Intergenic
1198567684 X:137921584-137921606 TCCCTACTCCCTCTCTCTCCTGG - Intergenic
1199471226 X:148198482-148198504 CCCTCCCGCAGTCTCTCACCAGG + Intergenic
1200223594 X:154404492-154404514 TCCCCACGGAGCCTCTTCCCAGG + Intronic