ID: 938397851

View in Genome Browser
Species Human (GRCh38)
Location 2:130963962-130963984
Sequence GGCGGCCGCGGGGCTGCCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938397851_938397858 -7 Left 938397851 2:130963962-130963984 CCCCCGGCAGCCCCGCGGCCGCC No data
Right 938397858 2:130963978-130964000 GGCCGCCGCACCGCCGCCCCCGG No data
938397851_938397868 16 Left 938397851 2:130963962-130963984 CCCCCGGCAGCCCCGCGGCCGCC No data
Right 938397868 2:130964001-130964023 CCCAGCCTTCCCCGAGCCTGTGG No data
938397851_938397875 27 Left 938397851 2:130963962-130963984 CCCCCGGCAGCCCCGCGGCCGCC No data
Right 938397875 2:130964012-130964034 CCGAGCCTGTGGCTGGAGCTCGG No data
938397851_938397876 28 Left 938397851 2:130963962-130963984 CCCCCGGCAGCCCCGCGGCCGCC No data
Right 938397876 2:130964013-130964035 CGAGCCTGTGGCTGGAGCTCGGG No data
938397851_938397870 20 Left 938397851 2:130963962-130963984 CCCCCGGCAGCCCCGCGGCCGCC No data
Right 938397870 2:130964005-130964027 GCCTTCCCCGAGCCTGTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938397851 Original CRISPR GGCGGCCGCGGGGCTGCCGG GGG (reversed) Intronic