ID: 938402019

View in Genome Browser
Species Human (GRCh38)
Location 2:131001527-131001549
Sequence AGTATTGGTGAGGATGTACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938402010_938402019 22 Left 938402010 2:131001482-131001504 CCATTCCATACCCTTCACATTGG No data
Right 938402019 2:131001527-131001549 AGTATTGGTGAGGATGTACAGGG No data
938402014_938402019 11 Left 938402014 2:131001493-131001515 CCTTCACATTGGCAGATGCGTTG No data
Right 938402019 2:131001527-131001549 AGTATTGGTGAGGATGTACAGGG No data
938402013_938402019 12 Left 938402013 2:131001492-131001514 CCCTTCACATTGGCAGATGCGTT No data
Right 938402019 2:131001527-131001549 AGTATTGGTGAGGATGTACAGGG No data
938402012_938402019 17 Left 938402012 2:131001487-131001509 CCATACCCTTCACATTGGCAGAT No data
Right 938402019 2:131001527-131001549 AGTATTGGTGAGGATGTACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938402019 Original CRISPR AGTATTGGTGAGGATGTACA GGG Intronic
No off target data available for this crispr