ID: 938403605

View in Genome Browser
Species Human (GRCh38)
Location 2:131014811-131014833
Sequence CACGACAGCACCAAATAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938403603_938403605 -1 Left 938403603 2:131014789-131014811 CCTCTTACCTTCAGTGAGATGGC No data
Right 938403605 2:131014811-131014833 CACGACAGCACCAAATAGCCAGG No data
938403604_938403605 -8 Left 938403604 2:131014796-131014818 CCTTCAGTGAGATGGCACGACAG No data
Right 938403605 2:131014811-131014833 CACGACAGCACCAAATAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938403605 Original CRISPR CACGACAGCACCAAATAGCC AGG Intronic
No off target data available for this crispr