ID: 938404977

View in Genome Browser
Species Human (GRCh38)
Location 2:131027154-131027176
Sequence TTGGCTGTACTGCTGGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938404977_938404981 19 Left 938404977 2:131027154-131027176 CCCTGCTCCAGCAGTACAGCCAA No data
Right 938404981 2:131027196-131027218 TCGTACAACACAAGACTGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938404977 Original CRISPR TTGGCTGTACTGCTGGAGCA GGG (reversed) Intronic
No off target data available for this crispr