ID: 938404977 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:131027154-131027176 |
| Sequence | TTGGCTGTACTGCTGGAGCA GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 938404977_938404981 | 19 | Left | 938404977 | 2:131027154-131027176 | CCCTGCTCCAGCAGTACAGCCAA | No data | ||
| Right | 938404981 | 2:131027196-131027218 | TCGTACAACACAAGACTGTGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 938404977 | Original CRISPR | TTGGCTGTACTGCTGGAGCA GGG (reversed) | Intronic | ||
| No off target data available for this crispr | |||||