ID: 938405384

View in Genome Browser
Species Human (GRCh38)
Location 2:131030031-131030053
Sequence CTGACTGCACACACCCAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938405379_938405384 12 Left 938405379 2:131029996-131030018 CCAGATGGTGTGAGGCTGTGCAG No data
Right 938405384 2:131030031-131030053 CTGACTGCACACACCCAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938405384 Original CRISPR CTGACTGCACACACCCAGCA GGG Intronic
No off target data available for this crispr