ID: 938406002

View in Genome Browser
Species Human (GRCh38)
Location 2:131033521-131033543
Sequence TGAACAGCTGGCCACCCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938406002_938406009 17 Left 938406002 2:131033521-131033543 CCTTCTGGGTGGCCAGCTGTTCA No data
Right 938406009 2:131033561-131033583 ATGAAGCATCCACACGTCAGGGG No data
938406002_938406007 15 Left 938406002 2:131033521-131033543 CCTTCTGGGTGGCCAGCTGTTCA No data
Right 938406007 2:131033559-131033581 CAATGAAGCATCCACACGTCAGG No data
938406002_938406008 16 Left 938406002 2:131033521-131033543 CCTTCTGGGTGGCCAGCTGTTCA No data
Right 938406008 2:131033560-131033582 AATGAAGCATCCACACGTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938406002 Original CRISPR TGAACAGCTGGCCACCCAGA AGG (reversed) Intronic