ID: 938406024

View in Genome Browser
Species Human (GRCh38)
Location 2:131033651-131033673
Sequence GAAGACATCTAAAGTCTCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938406024_938406028 6 Left 938406024 2:131033651-131033673 CCAGCGAGACTTTAGATGTCTTC No data
Right 938406028 2:131033680-131033702 CCCCAATTCTCCTGACAGCTTGG No data
938406024_938406033 9 Left 938406024 2:131033651-131033673 CCAGCGAGACTTTAGATGTCTTC No data
Right 938406033 2:131033683-131033705 CAATTCTCCTGACAGCTTGGGGG No data
938406024_938406030 7 Left 938406024 2:131033651-131033673 CCAGCGAGACTTTAGATGTCTTC No data
Right 938406030 2:131033681-131033703 CCCAATTCTCCTGACAGCTTGGG No data
938406024_938406032 8 Left 938406024 2:131033651-131033673 CCAGCGAGACTTTAGATGTCTTC No data
Right 938406032 2:131033682-131033704 CCAATTCTCCTGACAGCTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938406024 Original CRISPR GAAGACATCTAAAGTCTCGC TGG (reversed) Intronic