ID: 938406033

View in Genome Browser
Species Human (GRCh38)
Location 2:131033683-131033705
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938406024_938406033 9 Left 938406024 2:131033651-131033673 CCAGCGAGACTTTAGATGTCTTC No data
Right 938406033 2:131033683-131033705 CAATTCTCCTGACAGCTTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr