ID: 938414620

View in Genome Browser
Species Human (GRCh38)
Location 2:131093758-131093780
Sequence GGTGACCGCCACTACGGGGT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 38
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 32}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938414610_938414620 -1 Left 938414610 2:131093736-131093758 CCCGGGAGTCGAGCACACCCCGG 0: 1
1: 0
2: 1
3: 7
4: 76
Right 938414620 2:131093758-131093780 GGTGACCGCCACTACGGGGTCGG 0: 1
1: 0
2: 0
3: 5
4: 32
938414608_938414620 11 Left 938414608 2:131093724-131093746 CCTCAGGCCGCACCCGGGAGTCG 0: 1
1: 0
2: 0
3: 1
4: 80
Right 938414620 2:131093758-131093780 GGTGACCGCCACTACGGGGTCGG 0: 1
1: 0
2: 0
3: 5
4: 32
938414609_938414620 4 Left 938414609 2:131093731-131093753 CCGCACCCGGGAGTCGAGCACAC 0: 1
1: 0
2: 0
3: 4
4: 50
Right 938414620 2:131093758-131093780 GGTGACCGCCACTACGGGGTCGG 0: 1
1: 0
2: 0
3: 5
4: 32
938414605_938414620 24 Left 938414605 2:131093711-131093733 CCAGGGCGCGGATCCTCAGGCCG 0: 1
1: 0
2: 0
3: 6
4: 106
Right 938414620 2:131093758-131093780 GGTGACCGCCACTACGGGGTCGG 0: 1
1: 0
2: 0
3: 5
4: 32
938414612_938414620 -2 Left 938414612 2:131093737-131093759 CCGGGAGTCGAGCACACCCCGGG 0: 1
1: 0
2: 0
3: 8
4: 92
Right 938414620 2:131093758-131093780 GGTGACCGCCACTACGGGGTCGG 0: 1
1: 0
2: 0
3: 5
4: 32

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938414620 Original CRISPR GGTGACCGCCACTACGGGGT CGG Intergenic
903501188 1:23800848-23800870 GGTTACGGCCACTACGGGGAGGG + Intergenic
918188465 1:182148473-182148495 GGTGCCTGCCACTGAGGGGTAGG - Intergenic
1063099693 10:2938700-2938722 CGTGACCCTCACTCCGGGGTTGG - Intergenic
1065241016 10:23704432-23704454 GGGAACCGCAACTACTGGGTAGG - Intronic
1070615628 10:77967475-77967497 GGTGGCCCCCAGGACGGGGTTGG - Intergenic
1076711238 10:132335917-132335939 GGTGAGGGCAACTAAGGGGTGGG + Intronic
1076945586 10:133646977-133646999 GATGACCCCCACTGCGGGCTGGG + Intergenic
1084086892 11:66858983-66859005 GGTGACCGCCACCTCAGGGCTGG + Exonic
1084731177 11:71074672-71074694 GGTGAGGGCCACTAAGGGGCAGG + Intronic
1084802788 11:71555731-71555753 GGTGGCGGCCACTAGGGTGTGGG - Intronic
1092948762 12:13480819-13480841 GGCGACCCCCACTACTGGGTAGG + Intergenic
1107604950 13:42048345-42048367 GGGCATCGCCACTACGGGGTGGG + Intronic
1114756629 14:25267337-25267359 GGTGACGGCCACGACGGTGGCGG + Intergenic
1122887037 14:104714753-104714775 GGTGACCGACTCCTCGGGGTCGG + Exonic
1202919612 14_KI270723v1_random:18781-18803 GATGACCCCCACTGCGGGCTGGG + Intergenic
1132942057 16:2513378-2513400 GGTGACCGCAGCCACGGGCTGGG + Intronic
1133138333 16:3727877-3727899 GGTGACTGCGAGTCCGGGGTGGG + Exonic
1139657180 16:68396134-68396156 GGTGACAGCCACGGAGGGGTTGG - Intronic
1142251103 16:88992464-88992486 GGTCATCGCCTCTACAGGGTGGG + Intergenic
1152545440 17:80998007-80998029 GGTGTCCACCACTGCGGGGTGGG - Intronic
1160158448 18:76451605-76451627 GGCCACAGCTACTACGGGGTCGG + Intronic
1162481406 19:10928945-10928967 GGTGGCCGCCGCGACAGGGTGGG + Intronic
1165850894 19:38849815-38849837 GGTGGCCGCTACTACGGCGGCGG - Exonic
926936325 2:18089320-18089342 GGTGAGGGCAACTACGGGGGTGG + Intronic
929808656 2:45169903-45169925 CGCGACCGCCACCGCGGGGTGGG - Intergenic
938414620 2:131093758-131093780 GGTGACCGCCACTACGGGGTCGG + Intergenic
1171783576 20:29443072-29443094 GATGACCCCCACTGCGGGCTGGG + Intergenic
1172049912 20:32109627-32109649 GCTGACCGCCACTACAGGAGCGG + Exonic
957081896 3:75643490-75643512 GATGACCCCCACTGCGGGCTGGG - Intergenic
968596458 4:1488570-1488592 GGGGACCGCCACAACAGTGTAGG - Intergenic
969531422 4:7733075-7733097 GGTGTCCTCCACTAGGGGGGAGG - Intronic
971314117 4:25553001-25553023 GGAGACAGCCAGGACGGGGTTGG - Intergenic
985448974 4:190047489-190047511 GATGACCCCCACTGCGGGCTGGG + Intergenic
1019055766 6:169222247-169222269 GGTGAACTCCACCACGGGGACGG - Exonic
1023565521 7:41520703-41520725 GGTGACCTCCCCTACGGGATGGG + Intergenic
1028452873 7:91005267-91005289 GGTGAACACCACTTCGTGGTGGG + Intronic
1046503426 8:115108132-115108154 GGTGCCCGCCACCACGTGCTCGG - Intergenic
1197554615 X:127938161-127938183 TGTTACCACCACTGCGGGGTGGG + Intergenic