ID: 938415630

View in Genome Browser
Species Human (GRCh38)
Location 2:131101463-131101485
Sequence TCCAAGGAATAGGAGATAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938415630_938415642 22 Left 938415630 2:131101463-131101485 CCTGTTATCTCCTATTCCTTGGA No data
Right 938415642 2:131101508-131101530 GGGGTGTAGCAGGGGAGACATGG No data
938415630_938415634 2 Left 938415630 2:131101463-131101485 CCTGTTATCTCCTATTCCTTGGA No data
Right 938415634 2:131101488-131101510 CTCCACATTCCCAATTATGTGGG No data
938415630_938415639 12 Left 938415630 2:131101463-131101485 CCTGTTATCTCCTATTCCTTGGA No data
Right 938415639 2:131101498-131101520 CCAATTATGTGGGGTGTAGCAGG No data
938415630_938415633 1 Left 938415630 2:131101463-131101485 CCTGTTATCTCCTATTCCTTGGA No data
Right 938415633 2:131101487-131101509 GCTCCACATTCCCAATTATGTGG No data
938415630_938415640 13 Left 938415630 2:131101463-131101485 CCTGTTATCTCCTATTCCTTGGA No data
Right 938415640 2:131101499-131101521 CAATTATGTGGGGTGTAGCAGGG No data
938415630_938415635 3 Left 938415630 2:131101463-131101485 CCTGTTATCTCCTATTCCTTGGA No data
Right 938415635 2:131101489-131101511 TCCACATTCCCAATTATGTGGGG No data
938415630_938415641 14 Left 938415630 2:131101463-131101485 CCTGTTATCTCCTATTCCTTGGA No data
Right 938415641 2:131101500-131101522 AATTATGTGGGGTGTAGCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938415630 Original CRISPR TCCAAGGAATAGGAGATAAC AGG (reversed) Intergenic
No off target data available for this crispr