ID: 938415632

View in Genome Browser
Species Human (GRCh38)
Location 2:131101479-131101501
Sequence TTGGGAATGTGGAGCTTCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938415632_938415639 -4 Left 938415632 2:131101479-131101501 CCTTGGAAGCTCCACATTCCCAA No data
Right 938415639 2:131101498-131101520 CCAATTATGTGGGGTGTAGCAGG No data
938415632_938415641 -2 Left 938415632 2:131101479-131101501 CCTTGGAAGCTCCACATTCCCAA No data
Right 938415641 2:131101500-131101522 AATTATGTGGGGTGTAGCAGGGG No data
938415632_938415640 -3 Left 938415632 2:131101479-131101501 CCTTGGAAGCTCCACATTCCCAA No data
Right 938415640 2:131101499-131101521 CAATTATGTGGGGTGTAGCAGGG No data
938415632_938415642 6 Left 938415632 2:131101479-131101501 CCTTGGAAGCTCCACATTCCCAA No data
Right 938415642 2:131101508-131101530 GGGGTGTAGCAGGGGAGACATGG No data
938415632_938415643 30 Left 938415632 2:131101479-131101501 CCTTGGAAGCTCCACATTCCCAA No data
Right 938415643 2:131101532-131101554 ATTTTACTTCATGTTCTATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938415632 Original CRISPR TTGGGAATGTGGAGCTTCCA AGG (reversed) Intergenic
No off target data available for this crispr