ID: 938415639

View in Genome Browser
Species Human (GRCh38)
Location 2:131101498-131101520
Sequence CCAATTATGTGGGGTGTAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938415630_938415639 12 Left 938415630 2:131101463-131101485 CCTGTTATCTCCTATTCCTTGGA No data
Right 938415639 2:131101498-131101520 CCAATTATGTGGGGTGTAGCAGG No data
938415632_938415639 -4 Left 938415632 2:131101479-131101501 CCTTGGAAGCTCCACATTCCCAA No data
Right 938415639 2:131101498-131101520 CCAATTATGTGGGGTGTAGCAGG No data
938415631_938415639 2 Left 938415631 2:131101473-131101495 CCTATTCCTTGGAAGCTCCACAT No data
Right 938415639 2:131101498-131101520 CCAATTATGTGGGGTGTAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938415639 Original CRISPR CCAATTATGTGGGGTGTAGC AGG Intergenic
No off target data available for this crispr