ID: 938416157

View in Genome Browser
Species Human (GRCh38)
Location 2:131105322-131105344
Sequence GCCGGACGTGCGGCAGTTGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 65}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938416148_938416157 25 Left 938416148 2:131105274-131105296 CCGCCGCGCATGCGCGCCGAGGC 0: 1
1: 0
2: 1
3: 8
4: 66
Right 938416157 2:131105322-131105344 GCCGGACGTGCGGCAGTTGCAGG 0: 1
1: 0
2: 0
3: 2
4: 65
938416149_938416157 22 Left 938416149 2:131105277-131105299 CCGCGCATGCGCGCCGAGGCGTG 0: 1
1: 0
2: 0
3: 5
4: 42
Right 938416157 2:131105322-131105344 GCCGGACGTGCGGCAGTTGCAGG 0: 1
1: 0
2: 0
3: 2
4: 65
938416151_938416157 9 Left 938416151 2:131105290-131105312 CCGAGGCGTGACGTCAGAACGGC 0: 1
1: 0
2: 0
3: 0
4: 20
Right 938416157 2:131105322-131105344 GCCGGACGTGCGGCAGTTGCAGG 0: 1
1: 0
2: 0
3: 2
4: 65
938416146_938416157 26 Left 938416146 2:131105273-131105295 CCCGCCGCGCATGCGCGCCGAGG 0: 1
1: 0
2: 0
3: 9
4: 73
Right 938416157 2:131105322-131105344 GCCGGACGTGCGGCAGTTGCAGG 0: 1
1: 0
2: 0
3: 2
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938416157 Original CRISPR GCCGGACGTGCGGCAGTTGC AGG Exonic
916952528 1:169795180-169795202 GCAGGACGGACGGCAGTTCCCGG - Intronic
1065922342 10:30403621-30403643 GCCGCACATGCGGAAGATGCTGG - Intergenic
1069845989 10:71371926-71371948 GCAGGACCTGCTGCACTTGCAGG - Intergenic
1075416584 10:122268695-122268717 GCTGGACATGCGGCAGCTGGAGG - Intergenic
1075476733 10:122741872-122741894 GCCGAATGTGCAGCAGTTGTAGG - Intergenic
1076871815 10:133198271-133198293 GCCGGTGGTGCGGCACGTGCTGG + Intronic
1077102198 11:827349-827371 GCCGGGCGGGCGGCAGTGGAGGG - Intronic
1094199334 12:27780507-27780529 GCCGGGCCTGCGGCTGGTGCTGG + Exonic
1104179842 12:126368655-126368677 GCAGGAAGTGTGGCAGGTGCAGG + Intergenic
1108686803 13:52826641-52826663 GCGGGAGGTGCGGGAGTGGCAGG + Intergenic
1113717218 13:112519885-112519907 GCTGGACGTGCGGCTGCTGGAGG - Exonic
1113743515 13:112726615-112726637 GCCGGGGGTGCTGCAGATGCTGG + Intronic
1114254557 14:20990319-20990341 GCCGCACGTGCGGCAGCTTTAGG - Exonic
1122463217 14:101913029-101913051 GCCGGACGTCCCGGAGCTGCCGG + Intronic
1122826625 14:104373899-104373921 GCTGGAGGTGCTGCAGTGGCGGG - Intergenic
1135607323 16:23835980-23836002 GCTGGACGAGCGGCAGCAGCTGG + Intronic
1136466180 16:30445472-30445494 GCCGGACGTGCGGCCCCCGCTGG - Exonic
1139546876 16:67653607-67653629 GCCGGACGCGCAGCAGACGCAGG - Intronic
1143900670 17:10172314-10172336 GCCGGACATGCGGCAGAGGAAGG - Intronic
1144208008 17:12992925-12992947 GCGGGAGCTGCGGCAGGTGCGGG - Exonic
1146633584 17:34488010-34488032 GTGGGAGGAGCGGCAGTTGCAGG - Intergenic
1146819769 17:35975595-35975617 GCAGGAAGTGAGGCAGTTCCAGG + Intergenic
1148196406 17:45716440-45716462 GCCGGATGTATGGAAGTTGCTGG + Intergenic
1152867913 17:82735354-82735376 GCCGGACCTGCGTCCGCTGCGGG + Intergenic
1161684683 19:5696904-5696926 GCCGGATGTGTGGCACCTGCAGG + Intronic
1166853598 19:45771604-45771626 GGCACACGTCCGGCAGTTGCAGG - Exonic
1167650147 19:50724438-50724460 GACGGACGTGCAGCTGGTGCAGG - Exonic
929200332 2:39228574-39228596 GCAGGAAGTGCGGAAGCTGCTGG - Intronic
938416157 2:131105322-131105344 GCCGGACGTGCGGCAGTTGCAGG + Exonic
943433266 2:187830773-187830795 GCAGGACATGAGACAGTTGCAGG - Intergenic
946003007 2:216498791-216498813 GGCGGACGAGCGGAAGTGGCTGG - Exonic
947119601 2:226800484-226800506 GCCGGACGTGAGACACTTCCTGG - Intergenic
947542884 2:230990851-230990873 CCCGGGCGTGCTGCTGTTGCAGG - Intergenic
947873554 2:233453302-233453324 GCAGGAGGGGCGGCAGTGGCTGG - Intronic
1169113325 20:3046716-3046738 GCGGGAAGTGCTGCAGCTGCAGG + Exonic
1178840642 21:36135324-36135346 GGCGGCCGTGCAGCAGCTGCAGG + Exonic
1180159142 21:45991299-45991321 GCCGAGCGAGCGGCAGGTGCGGG - Intronic
951139693 3:19146849-19146871 GACGGACCTGCGGCAGAAGCAGG + Intergenic
952662392 3:35867525-35867547 GCAGGAGATGCTGCAGTTGCTGG - Intergenic
954249622 3:49357975-49357997 GGCGGACGTGCAGTAGTGGCTGG - Intronic
961501316 3:127338024-127338046 GCCAGGCGGGCGGCAGCTGCGGG + Intergenic
963845075 3:150147329-150147351 GCCGCACGTGAGCCAGCTGCAGG + Intergenic
964484602 3:157174794-157174816 GCCGGACCTGCAGGGGTTGCGGG - Intergenic
965605308 3:170492632-170492654 GCAGCACGTGCCTCAGTTGCTGG + Intronic
970481869 4:16484351-16484373 ACCGGTCGTGAGGCAGATGCTGG - Intergenic
976169169 4:82285332-82285354 GGCGCACGTGCGGCAGCCGCCGG - Intergenic
992080448 5:73231072-73231094 GCCGGCCTTGCCGCAGGTGCAGG + Intergenic
995650250 5:114361662-114361684 GCCCGACGTGCTGCAGTGGCTGG + Intronic
997303468 5:132823023-132823045 GCGGGCCGTGCGGGAGGTGCTGG - Exonic
997412683 5:133702364-133702386 GCCAGACCAGCGGCAGGTGCTGG + Intergenic
999291908 5:150431263-150431285 GCAGGAGGTGAGGCAGTGGCTGG + Intergenic
1003489237 6:6606703-6606725 GGCGGACCTGCAGCACTTGCGGG + Intronic
1005818790 6:29579677-29579699 GCCGGACGTTCAGTAGCTGCAGG + Intronic
1007451241 6:41941469-41941491 GCCGCACATGCGGAAGATGCTGG - Exonic
1013170784 6:107634904-107634926 GCAGGACCTGCGGCGGCTGCAGG + Exonic
1015808008 6:137131998-137132020 GCCGGATGTGGGGCAGAGGCTGG - Intergenic
1016982173 6:149863810-149863832 GCCGCTCCTGCTGCAGTTGCCGG + Exonic
1019571337 7:1713861-1713883 GCCGGGCGTGCGGCAGTGCTGGG - Intronic
1021610636 7:22454612-22454634 GCTGCACATGCTGCAGTTGCTGG + Intronic
1022310911 7:29194952-29194974 GCCGGACAGGCTGGAGTTGCTGG - Exonic
1029348726 7:99997681-99997703 GCCGGAAGTGTGGCGGGTGCCGG - Intergenic
1035751784 8:2001702-2001724 GCGGGACGTGCTGCGGGTGCAGG + Exonic
1036453563 8:8890595-8890617 GCAGGACTTGCAGCTGTTGCTGG - Exonic
1038041537 8:23727720-23727742 GCCGGGTGTGGGGCAGCTGCGGG - Intergenic
1042942627 8:74123144-74123166 GCCGGACGTGAGGCAGTTAATGG + Intergenic
1049451504 8:142664510-142664532 GCAGGAAGTGGGGCAGCTGCGGG - Exonic
1059717714 9:116929247-116929269 GGCGGAAGTGTGGCAGATGCAGG + Intronic
1195330241 X:103791441-103791463 GCCTGAGGAGCAGCAGTTGCTGG + Exonic