ID: 938418727

View in Genome Browser
Species Human (GRCh38)
Location 2:131126057-131126079
Sequence TAGATTATGAACCACATGGT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 114}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938418717_938418727 16 Left 938418717 2:131126018-131126040 CCATCTCAGAGGGGCGACCACAG 0: 1
1: 0
2: 0
3: 10
4: 109
Right 938418727 2:131126057-131126079 TAGATTATGAACCACATGGTCGG 0: 1
1: 0
2: 1
3: 10
4: 114
938418722_938418727 -1 Left 938418722 2:131126035-131126057 CCACAGTGGGGCCCCAGGCACTT 0: 1
1: 0
2: 1
3: 30
4: 231
Right 938418727 2:131126057-131126079 TAGATTATGAACCACATGGTCGG 0: 1
1: 0
2: 1
3: 10
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938418727 Original CRISPR TAGATTATGAACCACATGGT CGG Intronic
904530447 1:31165173-31165195 TAGATTAAGAACCACAGCTTTGG - Intergenic
905033275 1:34901809-34901831 TCGATTATGAAGGACATGGAAGG + Intronic
907028122 1:51142477-51142499 TAAATTATTCACCAAATGGTTGG + Intronic
908783499 1:67713027-67713049 CTGATTAAGAACCACATAGTGGG - Intronic
909148924 1:71975413-71975435 TAGATTAGGAAGGACATGATAGG + Intronic
910287240 1:85569426-85569448 TAGAACATGAACCACATCCTAGG - Intronic
911869974 1:103085108-103085130 TTGATTCTGAACTGCATGGTGGG - Intronic
913662789 1:121019590-121019612 TATATTGTAAAACACATGGTGGG + Intergenic
914014172 1:143802852-143802874 TATATTGTAAAACACATGGTGGG + Intergenic
914163649 1:145158344-145158366 TATATTGTAAAACACATGGTGGG - Intergenic
914652792 1:149711410-149711432 TATATTGTAAAACACATGGTGGG + Intergenic
918896618 1:190356683-190356705 TAGATTAAGAACCTTATGATTGG - Intronic
919073503 1:192786138-192786160 TAGTATATTAAGCACATGGTTGG + Intergenic
921131542 1:212224154-212224176 TAGATTATGAAGCACCTACTGGG + Intergenic
922192551 1:223332206-223332228 TATTTTATGAACCACATCTTAGG - Intronic
923443349 1:234042210-234042232 TTGATAATGATCCACATGGAAGG - Intronic
1069922622 10:71825832-71825854 CAGATGATGATGCACATGGTAGG - Exonic
1073354870 10:102845846-102845868 GAGATGATGAACCACATGGGTGG + Intergenic
1073895111 10:108146429-108146451 TAGTTTATGAAGTCCATGGTAGG - Intergenic
1079038344 11:17040424-17040446 GATATTATGAACCACATCGCAGG + Intergenic
1079038362 11:17040499-17040521 AATATTATGAACCACATTGCAGG + Intergenic
1083784154 11:64934224-64934246 TAGACCATGGACCCCATGGTGGG - Exonic
1084623524 11:70290606-70290628 AAGAGTATGAACTCCATGGTTGG - Intronic
1094441819 12:30486015-30486037 GACAGTATGAAGCACATGGTAGG + Intergenic
1097111914 12:56666247-56666269 TAGATGATGAACAACATGGGTGG - Exonic
1100911104 12:99364747-99364769 TAGTTGAGGAAACACATGGTTGG - Intronic
1109481946 13:62966385-62966407 TAGATTATGAATGTTATGGTGGG + Intergenic
1114437081 14:22715213-22715235 GAGGTTATGAGCCACACGGTGGG - Intergenic
1114437107 14:22715290-22715312 GAGGTTATGAGCCACATGGCAGG - Intergenic
1114437132 14:22715367-22715389 GAGGTTATGAGCCACATGGTGGG - Intergenic
1114437152 14:22715444-22715466 GAGGTTACGAGCCACATGGTGGG - Intergenic
1114544822 14:23491570-23491592 TATATTATTAATCTCATGGTTGG - Intronic
1120002545 14:79318904-79318926 TAGGGTATGAACCACAAGGAAGG - Intronic
1120127059 14:80756907-80756929 TACATTATGACCCACATCGCTGG - Exonic
1128708940 15:69857739-69857761 TAGAAGATGAGACACATGGTGGG - Intergenic
1129346169 15:74921109-74921131 TAGAATATGAACCACAGGGCTGG + Intronic
1135700363 16:24627070-24627092 TAGAATATAAACTACCTGGTTGG - Intergenic
1139305935 16:65986433-65986455 AAGCTTCTGAACCCCATGGTGGG - Intergenic
1143236634 17:5407402-5407424 TAGTTAAGGAACCACATGGCAGG + Intronic
1144596686 17:16575786-16575808 TATATTGTGATTCACATGGTGGG - Intergenic
1145356842 17:22166367-22166389 TAGATTATGAATGTTATGGTGGG - Intergenic
1156287477 18:35712624-35712646 TAGATTATCAAGCAAATGCTTGG - Intergenic
1158048926 18:53192014-53192036 AAGTTTATTAACCACATGGAAGG - Intronic
1158923254 18:62218742-62218764 TGGACTATGAGCCACTTGGTTGG + Intronic
1163874330 19:19854183-19854205 TGGATTATGCATCATATGGTTGG - Intergenic
1165639706 19:37373899-37373921 CAGATCATGAACCACCTTGTTGG + Intronic
927767320 2:25822840-25822862 GAGATGATGAACAACATGGGTGG + Intronic
928734808 2:34275838-34275860 TGGATTATAAACCATATTGTGGG + Intergenic
929089562 2:38201541-38201563 TAGAATATAACCCACATGGAGGG - Intergenic
930356300 2:50324993-50325015 TAGATTTTTAAACCCATGGTGGG - Intronic
931083839 2:58807023-58807045 AAGGTTACAAACCACATGGTGGG - Intergenic
934864749 2:97797687-97797709 TAGAATATGAATCTCATCGTTGG - Intronic
935018026 2:99202457-99202479 AAGATGAGGAAGCACATGGTAGG - Intronic
936823241 2:116550200-116550222 TAGATTATGGACAACTTTGTCGG + Intergenic
937284936 2:120744517-120744539 TATATTATGTACCACATCTTCGG - Intronic
938418727 2:131126057-131126079 TAGATTATGAACCACATGGTCGG + Intronic
939542816 2:143514261-143514283 TACAATATGGAGCACATGGTAGG + Intronic
940229816 2:151438932-151438954 TAGATTTTGGACCATGTGGTGGG - Intronic
941825958 2:169897327-169897349 AAGAGTATCAACCACATAGTGGG - Intronic
941994178 2:171585923-171585945 TAGTCTAAGAACCACAGGGTGGG - Intergenic
943230463 2:185244242-185244264 GAAATTATGAACCAAATAGTAGG - Intergenic
1169689783 20:8317391-8317413 TAGATTGTGAGCCCCATGGTAGG + Intronic
1170088949 20:12568837-12568859 TACAGTCTTAACCACATGGTTGG + Intergenic
1173295889 20:41756449-41756471 TTGATTATGGACCATATAGTGGG + Intergenic
1177272046 21:18861879-18861901 TAGCTTGTGAAGAACATGGTTGG + Intergenic
1182552165 22:31106398-31106420 TAGAGTAGGGACCAGATGGTAGG - Intronic
1182636449 22:31731262-31731284 TATATTAAGAACCCCATGTTAGG + Intronic
949675761 3:6451290-6451312 TAGTGTCTGAACCACATGGATGG - Intergenic
951041813 3:17996182-17996204 TAGTTTATGATCCATATGGTAGG - Intronic
952261899 3:31748101-31748123 TAGATGATGAACCAGGTGGAAGG - Exonic
954695007 3:52419341-52419363 TAGAGTATTCAACACATGGTTGG + Intronic
956091346 3:65670627-65670649 AAGCTAATGAACCACATAGTTGG + Intronic
958816432 3:98921299-98921321 TAGGTTATGAACAACTTGGGAGG + Intergenic
962279857 3:134042378-134042400 TAGATCATTAACAACATGCTTGG - Intronic
965196350 3:165601401-165601423 TAGATTATAAGCCAAATGGAGGG + Intergenic
965342351 3:167505443-167505465 TACATTATTAACCACAGGGATGG + Intronic
977132908 4:93265797-93265819 TTGATTTTGAACTGCATGGTGGG - Intronic
978651056 4:111005774-111005796 AAGACTATGAATCAGATGGTGGG - Intergenic
982509962 4:156269795-156269817 TGGATTACAAACCACATGGAAGG + Intergenic
983624764 4:169791308-169791330 GAGATGATGAACAACATGGGTGG - Intergenic
991303865 5:65155654-65155676 AAGATTATGAAACTCATGCTGGG + Intronic
991456158 5:66806911-66806933 CAGATTATGAACCACAGGAAAGG - Intronic
991569496 5:68039616-68039638 TAAATTAGGAACCAAATGGCAGG - Intergenic
995877304 5:116803699-116803721 TAAATTATGAACCATATGTTGGG + Intergenic
996189292 5:120518839-120518861 TAGATTATGAATGTCATGGCTGG + Intronic
997082624 5:130758607-130758629 TAGAAAATGAACAAAATGGTTGG + Intergenic
997143353 5:131406448-131406470 TAGATTATGAAACAGATGGTTGG - Intergenic
997652029 5:135529357-135529379 TATATTATCAACCTCATGGGTGG + Intergenic
997682641 5:135766906-135766928 GATATTATGAACCACATCATAGG - Intergenic
998007852 5:138668978-138669000 AAGAATATGAATCACAGGGTGGG - Intronic
999657003 5:153820129-153820151 TATCATATGTACCACATGGTAGG + Intergenic
1011467127 6:87669722-87669744 TAAAAAATGAAACACATGGTTGG - Intergenic
1014452026 6:121592769-121592791 TGGATTGTGAACCACATGTTGGG + Intergenic
1014495360 6:122115352-122115374 TAGATTGTTAACCAAAAGGTGGG - Intergenic
1015167867 6:130218863-130218885 TGGAATAGGAACCACATGGTAGG + Intronic
1020336378 7:7065469-7065491 GATATTATGAACCATATGGCAGG - Intergenic
1022599136 7:31739873-31739895 AAGTTCATGATCCACATGGTGGG - Intergenic
1022817512 7:33927809-33927831 AAGATGATGAACCACATTTTGGG - Intronic
1026684599 7:72497552-72497574 GAGATTAGGAAGCACATGCTAGG + Intergenic
1028329140 7:89566732-89566754 TATACGATGAACCACATGCTTGG + Intergenic
1032749975 7:134829631-134829653 TAGATTATACACGACATTGTAGG + Intronic
1037046787 8:14315443-14315465 AAGATTATGAAGCAAATGGAAGG + Intronic
1043117090 8:76270976-76270998 TATAGGATAAACCACATGGTAGG + Intergenic
1043633402 8:82364780-82364802 GATATTATGAACAACATGGCAGG - Intergenic
1044332364 8:90936180-90936202 TAGATCATTTAACACATGGTAGG - Intronic
1046787637 8:118285178-118285200 TAGATTATGCATTACATGGGTGG + Intronic
1047921453 8:129638886-129638908 TGGAGTATGAACCACCTGGATGG + Intergenic
1051612722 9:18977340-18977362 TAGATCATTTACCACATGCTGGG + Intronic
1055813867 9:80182591-80182613 AAGACTATGAACAGCATGGTGGG + Intergenic
1057671854 9:97097657-97097679 TAGATTATGAAAAACTTGGCAGG - Intergenic
1057973618 9:99580844-99580866 TTGATTACTGACCACATGGTAGG + Intergenic
1058214110 9:102211593-102211615 TACATTATCAACCACATACTTGG + Intergenic
1058496080 9:105560310-105560332 TAGATTATGAATCAGTAGGTGGG + Intronic
1060308940 9:122441854-122441876 TAGAGTTAGAAGCACATGGTGGG + Intergenic
1061796304 9:133087626-133087648 TAGATTCTGTCCCATATGGTGGG + Intergenic
1185590347 X:1272311-1272333 TAGCTTCTGAACCTCATTGTGGG - Intronic
1187033113 X:15509057-15509079 GAGTATATTAACCACATGGTAGG + Intronic
1188154675 X:26726179-26726201 TAGACTATGAAACAGATGATAGG + Intergenic
1188288442 X:28358688-28358710 TAGAAAATGAACCATATGGCAGG - Intergenic
1189368285 X:40406989-40407011 TAGATTATGACCCTCTGGGTAGG + Intergenic
1192384158 X:70648436-70648458 TTGATCATGAACAACATGGTGGG - Intronic
1194182728 X:90734059-90734081 CAGGTTATGAACCTCATTGTAGG + Intergenic
1195366622 X:104132741-104132763 AAGACTTTGAACCACAGGGTAGG + Intronic
1196010953 X:110887519-110887541 TAGGGTATCAAGCACATGGTAGG + Intergenic
1199206316 X:145152950-145152972 TAGATTGTGAACCACTCTGTGGG - Intergenic
1200529348 Y:4316014-4316036 CAGGTTATGAACCTCATTGTAGG + Intergenic