ID: 938422294

View in Genome Browser
Species Human (GRCh38)
Location 2:131154992-131155014
Sequence GCTATGGGCCGTGGGCTGCG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938422287_938422294 3 Left 938422287 2:131154966-131154988 CCCGCAGGCGGGCTCAGGCGGGA No data
Right 938422294 2:131154992-131155014 GCTATGGGCCGTGGGCTGCGAGG No data
938422279_938422294 28 Left 938422279 2:131154941-131154963 CCAGGCGAGGAGCTGCTGTGCGA No data
Right 938422294 2:131154992-131155014 GCTATGGGCCGTGGGCTGCGAGG No data
938422288_938422294 2 Left 938422288 2:131154967-131154989 CCGCAGGCGGGCTCAGGCGGGAG No data
Right 938422294 2:131154992-131155014 GCTATGGGCCGTGGGCTGCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938422294 Original CRISPR GCTATGGGCCGTGGGCTGCG AGG Intronic
No off target data available for this crispr