ID: 938422365

View in Genome Browser
Species Human (GRCh38)
Location 2:131155324-131155346
Sequence GCTTTCCACTGAAACGTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938422365_938422372 1 Left 938422365 2:131155324-131155346 CCTGCCACGTTTCAGTGGAAAGC No data
Right 938422372 2:131155348-131155370 GAGTGAACTGGAGTTGGGGATGG No data
938422365_938422374 3 Left 938422365 2:131155324-131155346 CCTGCCACGTTTCAGTGGAAAGC No data
Right 938422374 2:131155350-131155372 GTGAACTGGAGTTGGGGATGGGG No data
938422365_938422375 4 Left 938422365 2:131155324-131155346 CCTGCCACGTTTCAGTGGAAAGC No data
Right 938422375 2:131155351-131155373 TGAACTGGAGTTGGGGATGGGGG No data
938422365_938422373 2 Left 938422365 2:131155324-131155346 CCTGCCACGTTTCAGTGGAAAGC No data
Right 938422373 2:131155349-131155371 AGTGAACTGGAGTTGGGGATGGG No data
938422365_938422370 -3 Left 938422365 2:131155324-131155346 CCTGCCACGTTTCAGTGGAAAGC No data
Right 938422370 2:131155344-131155366 AGCCGAGTGAACTGGAGTTGGGG No data
938422365_938422376 7 Left 938422365 2:131155324-131155346 CCTGCCACGTTTCAGTGGAAAGC No data
Right 938422376 2:131155354-131155376 ACTGGAGTTGGGGATGGGGGAGG No data
938422365_938422368 -5 Left 938422365 2:131155324-131155346 CCTGCCACGTTTCAGTGGAAAGC No data
Right 938422368 2:131155342-131155364 AAAGCCGAGTGAACTGGAGTTGG No data
938422365_938422369 -4 Left 938422365 2:131155324-131155346 CCTGCCACGTTTCAGTGGAAAGC No data
Right 938422369 2:131155343-131155365 AAGCCGAGTGAACTGGAGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938422365 Original CRISPR GCTTTCCACTGAAACGTGGC AGG (reversed) Intronic
No off target data available for this crispr