ID: 938424914

View in Genome Browser
Species Human (GRCh38)
Location 2:131178495-131178517
Sequence CCATCCAGGAAAACACTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938424908_938424914 7 Left 938424908 2:131178465-131178487 CCCAAATCTCCAAGCTTGACGTT No data
Right 938424914 2:131178495-131178517 CCATCCAGGAAAACACTGGCTGG No data
938424910_938424914 -2 Left 938424910 2:131178474-131178496 CCAAGCTTGACGTTTTGCTTGCC No data
Right 938424914 2:131178495-131178517 CCATCCAGGAAAACACTGGCTGG No data
938424907_938424914 8 Left 938424907 2:131178464-131178486 CCCCAAATCTCCAAGCTTGACGT No data
Right 938424914 2:131178495-131178517 CCATCCAGGAAAACACTGGCTGG No data
938424909_938424914 6 Left 938424909 2:131178466-131178488 CCAAATCTCCAAGCTTGACGTTT No data
Right 938424914 2:131178495-131178517 CCATCCAGGAAAACACTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938424914 Original CRISPR CCATCCAGGAAAACACTGGC TGG Intronic
No off target data available for this crispr