ID: 938428355

View in Genome Browser
Species Human (GRCh38)
Location 2:131210318-131210340
Sequence CTGTGGAAGGGGTGGTTGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938428340_938428355 22 Left 938428340 2:131210273-131210295 CCTGTGGCTGGGTCAGGTTGTGG No data
Right 938428355 2:131210318-131210340 CTGTGGAAGGGGTGGTTGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938428355 Original CRISPR CTGTGGAAGGGGTGGTTGGG GGG Intronic
No off target data available for this crispr