ID: 938428355 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:131210318-131210340 |
| Sequence | CTGTGGAAGGGGTGGTTGGG GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 938428340_938428355 | 22 | Left | 938428340 | 2:131210273-131210295 | CCTGTGGCTGGGTCAGGTTGTGG | No data | ||
| Right | 938428355 | 2:131210318-131210340 | CTGTGGAAGGGGTGGTTGGGGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 938428355 | Original CRISPR | CTGTGGAAGGGGTGGTTGGG GGG | Intronic | ||
| No off target data available for this crispr | |||||