ID: 938428467

View in Genome Browser
Species Human (GRCh38)
Location 2:131210785-131210807
Sequence GGCTGCACTCCTTGGGGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938428467_938428485 24 Left 938428467 2:131210785-131210807 CCTGCTCCCCAAGGAGTGCAGCC No data
Right 938428485 2:131210832-131210854 CAGTTGCACCTGGATGGGGGTGG No data
938428467_938428482 20 Left 938428467 2:131210785-131210807 CCTGCTCCCCAAGGAGTGCAGCC No data
Right 938428482 2:131210828-131210850 TGGCCAGTTGCACCTGGATGGGG No data
938428467_938428480 18 Left 938428467 2:131210785-131210807 CCTGCTCCCCAAGGAGTGCAGCC No data
Right 938428480 2:131210826-131210848 TCTGGCCAGTTGCACCTGGATGG No data
938428467_938428483 21 Left 938428467 2:131210785-131210807 CCTGCTCCCCAAGGAGTGCAGCC No data
Right 938428483 2:131210829-131210851 GGCCAGTTGCACCTGGATGGGGG No data
938428467_938428481 19 Left 938428467 2:131210785-131210807 CCTGCTCCCCAAGGAGTGCAGCC No data
Right 938428481 2:131210827-131210849 CTGGCCAGTTGCACCTGGATGGG No data
938428467_938428476 0 Left 938428467 2:131210785-131210807 CCTGCTCCCCAAGGAGTGCAGCC No data
Right 938428476 2:131210808-131210830 CTGGTGGGCCCAGCAATTTCTGG No data
938428467_938428479 14 Left 938428467 2:131210785-131210807 CCTGCTCCCCAAGGAGTGCAGCC No data
Right 938428479 2:131210822-131210844 AATTTCTGGCCAGTTGCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938428467 Original CRISPR GGCTGCACTCCTTGGGGAGC AGG (reversed) Intronic
No off target data available for this crispr