ID: 938436304

View in Genome Browser
Species Human (GRCh38)
Location 2:131285478-131285500
Sequence GAGAATGGGGAGCACAAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938436304_938436314 10 Left 938436304 2:131285478-131285500 CCAGCCTTGTGCTCCCCATTCTC No data
Right 938436314 2:131285511-131285533 CTTTTCCAGTGTCAGCCAGCAGG No data
938436304_938436315 11 Left 938436304 2:131285478-131285500 CCAGCCTTGTGCTCCCCATTCTC No data
Right 938436315 2:131285512-131285534 TTTTCCAGTGTCAGCCAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938436304 Original CRISPR GAGAATGGGGAGCACAAGGC TGG (reversed) Intronic
No off target data available for this crispr